Introduction to Java Programming and Data Structures: Brief Version (11th Global Edition)
11th Edition
ISBN: 9780134671710
Author: Y. Daniel Liang
Publisher: PEARSON
expand_more
expand_more
format_list_bulleted
Concept explainers
Textbook Question
Chapter 20, Problem 20.11PE
(Match grouping symbols) A Java
- Parentheses: ( and )
- Braces: { and }
- Brackets: [ and ]
Note the grouping symbols cannot overlap. For example, (a{b)} is illegal. Write a program to check whether a Java source-code file has correct pairs of grouping symbols. Pass the source-code file name as a command-line argument.
Expert Solution & Answer
Want to see the full answer?
Check out a sample textbook solutionStudents have asked these similar questions
Description: Create (Java Program) a phonebook directory that will store the contact numbers of N persons. Your program should allow the user to add, view, delete, and update the contacts in the phonebook. Note that one person can have multiple contact numbers. The program will stop when the user command is ‘X’. Program command and entry should not be case-sensitive. That means commands ‘I’ or ‘i’ and the name “Jacky” or “JACKY” are the same. Each contact number can be 7 digits or 11 digits only.
The user should input a string containing the command, name, and contact number(s) (Limit the contact number of each person to three). This string should be broken down into fields in order to separate the different values and store them in their appropriate variables.
Use linked list in the implementation. Your node must declare at least four instance variables.
Program flow:
Command> I Jacky 09211234567
Remarks: New contact has been added.
Command> V Jacky Contact Number(s):…
:Write some statements that display a list of integers from 10 to 20
inclusive ,each with its square root next to it.
Write a single statement to find and display the sum of the successive
even integers 2, 4, ..., 200. (Answer: 10 100)
Ten students in a class write a test. The marks are out of 10. All the
marks are entered in a MATLAB vector marks. Write a statement to find
and display the average mark. Try it on the following marks:
580 10 3 85794 (Answer: 5.9)
Python question
Application: Python Fragment Formulation (Q1 – Q4)
In this group of questions you are asked to produce short pieces of Python code. When you are asked to "write a Python expression" to complete a task, you can either give the expression in one line or break down the task into several lines. The last expression you write must represent the required task.
Question 1 (Reduce parentheses)
Give an equivalent version of this expression by removing as many redundant parentheses as possible, without expanding the brackets or simplifying.
(x**(2**y))+(y*((z+x)**3))
Question 2 (Translate arithmetic concept into Python)
You are given a list of numbers, named numbers, containing 3 integers. Write a python expression (one line) that evaluates to True if and only if the product of any two numbers in the given list is greater than the sum of all three numbers.
Note: the product of two numbers, x and y is x*y.
Question 3 (List/table access)
You are given a table,…
Chapter 20 Solutions
Introduction to Java Programming and Data Structures: Brief Version (11th Global Edition)
Ch. 20.2 - Prob. 20.2.1CPCh. 20.2 - Prob. 20.2.2CPCh. 20.2 - Prob. 20.2.3CPCh. 20.2 - Prob. 20.2.4CPCh. 20.2 - Prob. 20.2.5CPCh. 20.3 - Prob. 20.3.1CPCh. 20.3 - Prob. 20.3.2CPCh. 20.3 - Prob. 20.3.3CPCh. 20.3 - Prob. 20.3.4CPCh. 20.4 - Prob. 20.4.1CP
Ch. 20.4 - Prob. 20.4.2CPCh. 20.5 - Prob. 20.5.1CPCh. 20.5 - Suppose list1 is a list that contains the strings...Ch. 20.5 - Prob. 20.5.3CPCh. 20.5 - Prob. 20.5.4CPCh. 20.5 - Prob. 20.5.5CPCh. 20.6 - Prob. 20.6.1CPCh. 20.6 - Prob. 20.6.2CPCh. 20.6 - Write a lambda expression to create a comparator...Ch. 20.6 - Prob. 20.6.4CPCh. 20.6 - Write a statement that sorts an array of Point2D...Ch. 20.6 - Write a statement that sorts an ArrayList of...Ch. 20.6 - Write a statement that sorts a two-dimensional...Ch. 20.6 - Write a statement that sorts a two-dimensional...Ch. 20.7 - Are all the methods in the Collections class...Ch. 20.7 - Prob. 20.7.2CPCh. 20.7 - Show the output of the following code: import...Ch. 20.7 - Prob. 20.7.4CPCh. 20.7 - Prob. 20.7.5CPCh. 20.7 - Prob. 20.7.6CPCh. 20.8 - Prob. 20.8.1CPCh. 20.8 - Prob. 20.8.2CPCh. 20.8 - Prob. 20.8.3CPCh. 20.9 - How do you create an instance of Vector? How do...Ch. 20.9 - How do you create an instance of Stack? How do you...Ch. 20.9 - Prob. 20.9.3CPCh. 20.10 - Prob. 20.10.1CPCh. 20.10 - Prob. 20.10.2CPCh. 20.10 - Prob. 20.10.3CPCh. 20.11 - Can the EvaluateExpression program evaluate the...Ch. 20.11 - Prob. 20.11.2CPCh. 20.11 - If you enter an expression "4 + 5 5 5", the...Ch. 20 - (Display words in ascending alphabetical order)...Ch. 20 - (Store numbers in a linked list) Write a program...Ch. 20 - (Guessing the capitals) Rewrite Programming...Ch. 20 - (Sort points in a plane) Write a program that...Ch. 20 - (Combine colliding bouncing balls) The example in...Ch. 20 - (Game: lottery) Revise Programming Exercise 3.15...Ch. 20 - Prob. 20.9PECh. 20 - Prob. 20.10PECh. 20 - (Match grouping symbols) A Java program contains...Ch. 20 - Prob. 20.12PECh. 20 - Prob. 20.14PECh. 20 - Prob. 20.16PECh. 20 - (Directory size) Listing 18.10,...Ch. 20 - Prob. 20.20PECh. 20 - (Nonrecursive Tower of Hanoi) Implement the...Ch. 20 - Evaluate expression Modify Listing 20.12,...
Additional Engineering Textbook Solutions
Find more solutions based on key concepts
What is an uninitialized variable?
Starting Out with Programming Logic and Design (4th Edition)
An online or hard-copy repository for all project correspondence, inputs, outputs, deliverables, procedures, an...
Essentials of Systems Analysis and Design (6th Edition)
Why is the study of database technology important?
Database Concepts (7th Edition)
The job of the _____ is to fetch instructions, carry out the operations commanded by the instructions, and prod...
Starting Out With Visual Basic (7th Edition)
Apply the normalization process to the Veterinary Office ListVersion One relation shown in Figure 1-34 (see pag...
Database Concepts (8th Edition)
Convert each of the following binary representations to its equivalent base ten form: a. 101010 b. 100001 c. 10...
Computer Science: An Overview (13th Edition) (What's New in Computer Science)
Knowledge Booster
Learn more about
Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, computer-science and related others by exploring similar questions and additional content below.Similar questions
- *Please help in javascript* Summary: Given integer values for red, green, and blue, subtract the gray from each value. Computers represent color by combining the sub-colors red, green, and blue (rgb). Each sub-color's value can range from 0 to 255. Thus (255, 0, 0) is bright red, (130, 0, 130) is a medium purple, (0, 0, 0) is black, (255, 255, 255) is white, and (40, 40, 40) is a dark gray. (130, 50, 130) is a faded purple, due to the (50, 50, 50) gray part. (In other words, equal amounts of red, green, blue yield gray). Given values for red, green, and blue, remove the gray part. Ex: If the input is: 130 50 130 the output is: 80 0 80 import java.util.Scanner; public class LabProgram {public static void main(String[] args) {/* Type your code here. */}}arrow_forwardPlease help! (Java) The objective is to write a program that reads CSV data and emits HTML data. Theprogram should accept input line-by-line in CSV format and produceoutput line-by-line in HTML format. You may use Scanners but should not need any otherimports. Note that regular expressions are forbidden.arrow_forwarddef swap_text(text): Backstory: Luffy wants to organize a surprise party for his friend Zoro and he wants to send a message to his friends, but he wants to encrypt the message so that Zoro cannot easily read it. The message is encrypted by exchanging pairs of characters. Description: This function gets a text (string) and creates a new text by swapping each pair of characters, and returns a string with the modified text. For example, suppose the text has 6 characters, then it swaps the first with the second, the third with the fourth and the fifth with the sixth character. Parameters: text is a string (its length could be 0)Return value: A string that is generated by swapping pairs of characters. Note that if the Examples: swap_text ("hello") swap_text ("Party for Zoro!") swap_text ("") def which_day(numbers): → 'ehllo'→ 'aPtr yof roZor!' → '' length of the text is odd, the last character remains in the same position.arrow_forward
- T/F 3) The parameter (String[ ] variable) is used in a Java key method such that a user may run the software and supply "command-line" parameters. The operator, on the other hand, does not need to have any parameters since the parameter is a String sequence.arrow_forwardJAVA (Baby name popularity ranking) The popularity ranking of baby names from the years 1960s to 2010 are stored in files named babynameranking_1960s.txt, babynameranking 1970s.txt,., babynameranking 2010s.txt (See the attached zip file). Each file contains two hundred lines. Each line contains a ranking, a boy's name, a number for the boy's name, a girl's name, and a number for the girl's name. For example, the first two lines in the file babynameranking_2010s.txt are as follows: 1 Noah 182,896 Emma 194,667 2 Liam 173,636 Olivia 184, 192 So, the boy's name Noah and the girl's name Emma are ranked #1 and the boy's name Liam and the girl's name Olivia are ranked #2. 182,896 boys are named Noah and 194,667 girls are named Emma in the 2010s. Write a program that prompts the user to enter the year, gender, and followed by a name, and displays the ranking of the name for the year. Example Run of it. Enter the year: 2010 Enter the gender: M Enter the name: John Boy name John is ranked #26 in…arrow_forwardCode write () 9.arrow_forward
- python: def shakespeare_position(role, section): """ Question 2 - Regex You are reading a Shakespeare play with your friends (as one frequently does) and are given a role. You want to know what line immediately precedes YOUR first line in a given section so that you are ready to go when it is your turn. Return this line as a string, excluding the character's name. Lines will always begin with the character's name followed by a ':' and end in a "." or a "?" Each line is separated by a single space. THIS MUST BE DONE IN ONE LINE. "" Args: role (str) section (str) Returns: str section_1 = 'Benvolio: By my head, here come the Capulets. Mercutio: By my heel, I care not. ' + 'Tybalt: Gentlemen, good den - a word with one of you. Mercutio: And but one word with one of us?' >>> shakespeare_position('Tybalt', section_1) 'By my heel, I care not.' >>> shakespeare_position('Mercutio', section_1) 'By my head, here…arrow_forward[JAVA Code] In this lab, you will open the file, flowers.dat, and read input from that file in a pre-written Java program. The program should read and print the names of flowers and whether they are grown in shade or sun. // Flowers.java - This program reads names of flowers and whether they are grown in shade or sun from an input // file and prints the information to the user's screen. // Input: flowers.dat. // Output: Names of flowers and the words sun or shade. import java.io.*; // Import class for file input. public class Flowers { public static void main(String args[]) throws Exception { // Declare variables here // Open input file. // Create BufferedReader object. // Write while loop that reads records from file. // Print flower name and the words sun or shade. br.close(); System.exit(0); } // End of main() method. } // End of Flowers class.arrow_forwardJAVA (Baby name popularity ranking) The popularity ranking of baby names from the years 1960s to 2010 are stored in files named babynameranking_1960s.txt, babynameranking_1970s.txt,…, babynameranking_2010s.txt (See the attached zip file). Each file contains two hundred lines. Each line contains a ranking, a boy’s name, a number for the boy’s name, a girl’s name, and a number for the girl’s name. For example, the first two lines in the file babynameranking_2010s.txt are as follows: 1 Noah 182,896 Emma 194,667 2 Liam 173,636 Olivia 184,192 · So, the boy’s name Noah and the girl’s name Emma are ranked #1 and the boy’s name Liam and the girl’s name Olivia are ranked #2. 182,896 boys are named Noah and 194,667 girls are named Emma in the 2010s. Write a program that prompts the user to enter the year, gender, and followed by a name, and displays the ranking of the name for the year.Example Run of it. Enter the year: 2010 Enter the gender: M Enter the…arrow_forward
- Consider the following pseudo code, Method func() { PRINT “This is recursive function" func() } Method main( { func() } What will happen when the above snippet is executed?arrow_forwardC++ Code: This function will print out the information that has been previously read (using the function readData) in a format that aligns an individual's STR counts along a column. For example, the output for the above input will be: name Alice Bob Charlie ---------------------------------------- AGAT 5 3 6 AATG 2 7 1 TATC 8 4 5 This output uses text manipulators to left-align each name and counts within 10 characters. The row of dashes is set to 40 characters. /** * Computes the longest consecutive occurrences of several STRs in a DNA sequence * * @param sequence a DNA sequence of an individual * @param nameSTRs the STRs (eg. AGAT, AATG, TATC) * @returns the count of the longest consecutive occurrences of each STR in nameSTRs **/ vector<int> getSTRcounts(string& sequence, vector<string>& nameSTRs) For example, if the sequence is AACCCTGCGCGCGCGCGATCTATCTATCTATCTATCCAGCATTAGCTAGCATCAAGATAGATAGATGAATTTCGAAATGAATGAATGAATGAATGAATGAATG and the vector namesSTRs is…arrow_forwardArt.java In this part you will create a program Art.java that produces a recursive drawing of the design attached in the picture. Requirements Art.java must take one (1) integer command-line argument n that controls the depth of recursion. Your drawing must stay within the drawing window when n is between 1 and 7. (The autograder will not test values of n outside of this range.) You may not change the size of the drawing window (but you may change the scale). Do not add sound. Your drawing can be a geometric pattern, a random construction, or anything else that takes advantage of recursive functions. Optionally, you may use the Transform2D library you implemented in Part 1. You may also define additional geometric transforms in Art.java, such as sheer, reflect across the x- or y- axis, or rotate about an arbitrary point (as opposed to the origin). Your program must be organized into at least three separate functions, including main(). All functions except main() must be private. call…arrow_forward
arrow_back_ios
SEE MORE QUESTIONS
arrow_forward_ios
Recommended textbooks for you
- Database System ConceptsComputer ScienceISBN:9780078022159Author:Abraham Silberschatz Professor, Henry F. Korth, S. SudarshanPublisher:McGraw-Hill EducationStarting Out with Python (4th Edition)Computer ScienceISBN:9780134444321Author:Tony GaddisPublisher:PEARSONDigital Fundamentals (11th Edition)Computer ScienceISBN:9780132737968Author:Thomas L. FloydPublisher:PEARSON
- C How to Program (8th Edition)Computer ScienceISBN:9780133976892Author:Paul J. Deitel, Harvey DeitelPublisher:PEARSONDatabase Systems: Design, Implementation, & Manag...Computer ScienceISBN:9781337627900Author:Carlos Coronel, Steven MorrisPublisher:Cengage LearningProgrammable Logic ControllersComputer ScienceISBN:9780073373843Author:Frank D. PetruzellaPublisher:McGraw-Hill Education
Database System Concepts
Computer Science
ISBN:9780078022159
Author:Abraham Silberschatz Professor, Henry F. Korth, S. Sudarshan
Publisher:McGraw-Hill Education
Starting Out with Python (4th Edition)
Computer Science
ISBN:9780134444321
Author:Tony Gaddis
Publisher:PEARSON
Digital Fundamentals (11th Edition)
Computer Science
ISBN:9780132737968
Author:Thomas L. Floyd
Publisher:PEARSON
C How to Program (8th Edition)
Computer Science
ISBN:9780133976892
Author:Paul J. Deitel, Harvey Deitel
Publisher:PEARSON
Database Systems: Design, Implementation, & Manag...
Computer Science
ISBN:9781337627900
Author:Carlos Coronel, Steven Morris
Publisher:Cengage Learning
Programmable Logic Controllers
Computer Science
ISBN:9780073373843
Author:Frank D. Petruzella
Publisher:McGraw-Hill Education
Literals in Java Programming; Author: Sudhakar Atchala;https://www.youtube.com/watch?v=PuEU4S4B7JQ;License: Standard YouTube License, CC-BY
Type of literals in Python | Python Tutorial -6; Author: Lovejot Bhardwaj;https://www.youtube.com/watch?v=bwer3E9hj8Q;License: Standard Youtube License