![EBK BIOLOGY](https://www.bartleby.com/isbn_cover_images/8220102797376/8220102797376_largeCoverImage.jpg)
EBK BIOLOGY
4th Edition
ISBN: 8220102797376
Author: BROOKER
Publisher: YUZU
expand_more
expand_more
format_list_bulleted
Concept explainers
Question
Chapter 20.1, Problem 3CC
Summary Introduction
To determine:
The DNA fragment that will be closer to the bottom of the gel.
Introduction:
Gel Electrophoresis is a widely used technique in the field of molecular biology. It is used for the separation of a variety of
Expert Solution & Answer
![Check Mark](/static/check-mark.png)
Want to see the full answer?
Check out a sample textbook solution![Blurred answer](/static/blurred-answer.jpg)
Students have asked these similar questions
Application/ Analysis
Explain how the anti-parallel structure of DNA predicts its replication mechanism.
Identify the major and minor groove of DNA and explain why they are there.
Differentiate between semiconservative, conservative, and dispersive replication.
Interpret a diagram of a bi-directional replication fork and correctly determine strand polarity and fork direction.
VISUAL SKILLS If the DNA pol I in a given cell werenonfunctional, how would that affect the synthesis ofa leading strand? In the overview box in Figure 16.17,point out where DNA pol I would normally function onthe top leading strand.
Practice: DNA Structure and Replication
1. Label each part of the model to the right. Include specific nitrogen base pairs
in your labeling.
2. What molecule is it?
3. What is its purpose?
4. Where can it be found in a prokaryotic cell?
5. Where can it be found in a eukaryotic cell?
6. It gets copied during a process called replication. When does this happen?
7. What is the result of DNA replication?
8. Why is DNA replication necessary?
10. What would the chromosome to the right look like after DNA replication?
11. What would the chromosome to the right be called after DNA replication?
9. Why is DNA replication said to be semi-conservative? Draw a picture to support your answer.
TAACCGAGTTCAGA
b. TTAACCGAGTTCAGA
Genetics Unit
Sol
Sol
Dal
12. Replicate the following four DNA strands using what you know about complementary base pairs.
TACOTCCAGATITT
a. AATACGTCCAGATTTT
c. CCCGCGGAATATACA
O
book
It's Not Rocket Science 2016
d. AGGGCTACTTCAGAC
J
7
Chapter 20 Solutions
EBK BIOLOGY
Ch. 20.1 - Prob. 1CCCh. 20.1 - Prob. 1BCCh. 20.1 - Prob. 2CCCh. 20.1 - Prob. 3CCCh. 20.1 - Prob. 4CCCh. 20.1 - Prob. 2BCCh. 20.2 - Prob. 1CCCh. 20.2 - Prob. 2CCCh. 20.2 - Prob. 3CCCh. 20.3 - Prob. 1CC
Ch. 20.3 - Prob. 2CCCh. 20.3 - Prob. 3CCCh. 20.3 - Prob. 4CCCh. 20.3 - Prob. 1EQCh. 20.3 - Prob. 2EQCh. 20.3 - Prob. 3EQCh. 20 - Prob. 1TYCh. 20 - Prob. 2TYCh. 20 - DNA ligase is needed in a cloning experiment a. to...Ch. 20 - Prob. 4TYCh. 20 - Why is Taq polymerase used in PCR rather than...Ch. 20 - Lets suppose you want to clone a gene that has...Ch. 20 - Prob. 7TYCh. 20 - Prob. 8TYCh. 20 - Prob. 9TYCh. 20 - Prob. 10TYCh. 20 - Prob. 1CQCh. 20 - Prob. 2CQCh. 20 - Prob. 3CQCh. 20 - Identify and discuss three important advances that...Ch. 20 - Prob. 2COQ
Knowledge Booster
Learn more about
Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.Similar questions
- Primer Development Pick your favorite gene and develop primers for a target within the gene. Provide the following information: Gene name: Species: Accession number: Primer target: Primer Output: Explain why you selected this primer set.arrow_forwardProtein Synthesis and Mutation Practice • Complete the lines below by determining the mRNA transcript and amino acid sequence. • Compare the mutant DNA strands to the wild type strand. ⚫ Circle the mutation in the mutant DNA strands and describe the type of mutation (frameshift - insertion, frameshift - deletion, point - missense, point - silent, or point-nonsense). Not all of these will be used in this assignment! Wild type DNA template: 3' TACGCGTGCACGATGCAGTAGTACATC5' mRNA transcript sequence: Amino acid sequence: Mutation #1 DNA template: 3' TACGCGTGCACGATCCAGTAGTACATC5' mRNA transcript sequence: Amino acid sequence: Type of mutation: Mutation #2 DNA template: 3' TACGCGTGCTCGATGCAGTAGTACATC5' mRNA transcript sequence: Amino acid sequence: Type of mutation:arrow_forwardDNA Olympics (warm up) Name Caitlin MYers Period DIRECTIONS: Complete each of the following “events" in their proper order. In the first event, you must transcribe the proper RNA sequence from the DNA sequence provided. In the next event, you must translate the RNA strand that you have just created and use it to create the proper string of AMINO ACIDS and, eventually, the proper PROTEIN'. When your protein is completed, the final event is to match your protein with its proper trait (ex: tongue rolling). 1. A TGCATGCGCGACTG GGG TC GGAGTGGarrow_forward
- Primer designing: A single-stranded DNA sequence (963 nucleotides) that codes for a hypothetical protein are shown below (lower case shaded blue). 1. Design a pair of forward and reverse primers (~18 nucleotides long each) with EcoRI and BamHI added at 5' and 3' ends, respectively, for the amplification and cloning of this a plasmid with the same restriction sites. gene into GTATCGATAAGCTTGATATCGAATTCatggctaaaggcggagct cccgggttca aagtcgcaat acttggcgct gccggtggcattggccagccccttgcgatgttgatgaagatgaatcctctggtttctgttctacatctatatgatgtagtcaatgcccctggtgtcaccgctgatatta gccacatggacacgggtgctgtggtgcgtggattcttggggcagcagcagctggaggctgcgcttactggcatggatcttattatagtccctgcaggtgttcctcg aaaaccaggaatgacgagggatgatctgttcaaaataaacgcaggaattgtcaagactctgtgtgaagggattgcaaagtgttgtccaagagccattgtcaacctg atcagtaatcctgtgaactccaccgtgcccatcgcagctgaagttttcaagaaggctggaacttatgatccaaagcgacttctgggagttacaatgctcgacgtagt cagagccaatacctttgtggcagaagtattgggtcttgatcctcgggatgttgatgttccagttgttggcggtcatgetggtgtaaccatttgccccttctatctcagg…arrow_forwardHome Work: • Suppose you perform a PCR that begins with one double-strand of the following DNA template: +5' -СТАССТСCGGGTTGACTGСТАССТТССССGGATGCCCAAAAТТСТСGAG-3— :::::::::::: :::::::::::: :::: +3'-GATGGACССССААСТGACGATGGAAGGGCCCТАССGGTTTTAAGAGCTC-5'+ A. Draw one cycle of PCR reaction below the following diagram. B. Label the template DNA, the primers, and what is happening at each step. (1) température cycle #1arrow_forward(b) Use a drawing to illustrate the principle of DNA gel electrophoresis. +arrow_forward
- Ⓒ Macmillan Learning The table shows where different restriction endonucleases (restriction enzymes) cleave DNA. The abbreviation R represents the purines (adenine and guanine). The pyrimidines (cytosine, thymine, and uracil) are abbreviated as Y. The abbreviation W represents adenine or thymine. Enzyme Target sequence 5' GAATTC 3' 3' CTTAAG 5' EcoRI ECORV HaeIII HindIII PpUMI 5' GATATC 3' 3' CTATAG 5' EcoRI HindIII EcoRV HaeIII 5' GGCC 3' 3' CCGG 5' Incorrect 5' AAGCTT 3' 3' TTCGAA 5' 5' RGGWCCY 3' 3' YCCWGGR 5' 5' TCAGAATTCGGTGA 3' Cleavage 5' G 3' CTTAA 5' GAT 3' CTA 5' GG 3' CC AATTC 3' G5' ATC 3' TAG 5' CC 3' GG 5' AGCTT 3' A 5' Which restriction endonucleases would cleave a DNA molecule at the given sequences? The complementary DNA substrate strand is omitted for clarity. 5' A 3' TTCGA 5' RG GWCCY 3' 3' YCCWG GR 5' 5' TCCAAGCTTGAATTC 3' EcoRV HaeIII HindIII EcoRI Incorrect Macmillan Learningarrow_forwardShow all work. 1. A) Produce a double-stranded piece of DNA that is 11 base pairs long using the letters A, C, G, T and label the ends of both strands using 3' and 5' appropriately. B) Calculate the ratio of (A+T)/(G+C) and (A+G)/(C+T). Explain why one ratio will always be equal to 1.0?arrow_forwardGenetic Engineering Process (GEP) # 1: (What kind of process?) Picture A (Sequence #_ DNA introduced into bacterial cells Picture B (Sequence #, DNA ligase added, seals overhangs TTAA AATT AAT AATT TAA TTA TAA PATT PATT AATT recombinant DNA molecules Picture C (Sequence #. donor DNA vector vector and donor DNA digested (cleaved) with restriction enzyme AATT AATT 1477 AATT TTAA overhangs TTAA 1477 Picture D (Sequence #. AATT mixing recombinant DNA molecules replicate and cells dividearrow_forward
- AKS 5b: Which statement is correct regarding the semiconservative nature of DNA? * The semiconservative nature of DNA allows for genetic stability in somatic gene production MRNA operates as a template to allow DNA to replicate itself using ribosomes The structure of the phosphate group on the DNA molecule direct the correct nucleotides into place during replication Nucleotides in each original strand serve as a template for the new strand to be made AKS 5b: Which model accurately represents the semi-conservative nature of DNA replication? * * AA AA AA AA АВ ВА AA BB AA AA АВ АС Figure A Figure B Figure C Figure Darrow_forwardExperiment: Bradford protein assaygive the answers (4-5 lines) of review questions in the end. the answer should be logical and understandable and without plagiarism. avoid copy-pasting. PLEASE GIVE THE ANSWER OF 3rd AND 4th QUESTION. ITS COMPULSORY.Background information:The Bradford assay is very fast and uses about the same amount of protein as the Lowry assay. It is fairly accurate and samples that are out of range can be retested within minutes. The Bradford is recommended for general use, especially for determining protein content of cell fractions and assessing protein concentrations for gel electrophoresis. The method described below is for a 100 µl sample volume using 5 ml color reagent. It is sensitive to about 5 to 200 micrograms protein, depending on the dye quality. In assays using 5 ml color reagent prepared in lab, the sensitive range is closer to 5 to 100 µg protein. Scale down the volume for the "micro assay procedure," which uses 1 ml cuvettes. Protocols, including…arrow_forwardPreparing plasmid DNA (double stranded, circular) for Sanger sequencing involves annealing a complementary, single-stranded oligonucleotide DNA primer to one strand of the plasmid template. This is routinely accomplished by heating the plasmid DNA and primer to 90°C and then slowly bringing the temperature down to 25°C. Why does this protocol work? What enzyme is used and what other components are required in the sequencing reaction? How does the Sanger method determine the sequence?arrow_forward
arrow_back_ios
SEE MORE QUESTIONS
arrow_forward_ios
Recommended textbooks for you
- Human Heredity: Principles and Issues (MindTap Co...BiologyISBN:9781305251052Author:Michael CummingsPublisher:Cengage Learning
![Text book image](https://www.bartleby.com/isbn_cover_images/9781305251052/9781305251052_smallCoverImage.gif)
Human Heredity: Principles and Issues (MindTap Co...
Biology
ISBN:9781305251052
Author:Michael Cummings
Publisher:Cengage Learning
Molecular Techniques: Basic Concepts; Author: Dr. A's Clinical Lab Videos;https://www.youtube.com/watch?v=7HFHZy8h6z0;License: Standard Youtube License