CAMPBELL BIOLOGY-MASTERING BIO.ACCESS
12th Edition
ISBN: 9780136486787
Author: Urry
Publisher: SAVVAS L
expand_more
expand_more
format_list_bulleted
Question
Chapter 21.2, Problem 3CC
Summary Introduction
To analyze: Roles of RNAs apart from acting as protein-coding genes.
Introduction: RNA (ribonucleic acid) is a single-stranded
Expert Solution & Answer
Want to see the full answer?
Check out a sample textbook solution
Students have asked these similar questions
• Draw a figure of a gene model containing labeled 5' and 3' UTRs, exons, and introns. Label
the promoter region, the transcription start site and the translation start and stop.
• Use your figure to show how alternative splicing can generate two different mature
mRNAs from your gene model that nevertheless share some coding sequence. Draw these
alternative mRNAs and indicate where are the 5' and 3' UTRs in the mature mRNAs.
© Macmillan Learning
Predict the amino acid sequences of peptides formed by ribosomes in response to each mRNA sequence, assuming that the
reading frame begins with the first three bases in each sequence. Construct the peptides using the one-letter codes of the
amino acids.
GQSLI
GGUCAGUCGCUCCUGAUU:
Incorrect Answer
UUGGAUGCGCCAUAAUUUGCU:
LDAP
Correct Answer
< Feedback
O Macmillan Learning
Sorry, that's incorrect.
You have not correctly entered the
Х
peptide sequence corresponding to the
first mRNA sequence.
The codons within the first mRNA
sequence are: GGU, CAG, UCG, CUC,
CUG, and AUU. Find each codon
within the amino acid codon table and
identify its corresponding amino acid.
HDRCA
CAUGAUGCCUGUUGCUAC:
Incorrect Answer
MDE
AUGGACGAA:
Correct Answer
Macmillan Learning
Label the structural features of the yeast phenylalanine tRNA.
Answer Bank
region that carries the amino acid
at its end
Extra arm
5' end
region that contains the bases
ribothymidine and pseudouridine
region that contains the
base dihydrouridine
region that contains the anticodon,
which base pairs with the mRNA
Chapter 21 Solutions
CAMPBELL BIOLOGY-MASTERING BIO.ACCESS
Ch. 21.1 - Describe the whole-genome shotgun approach.Ch. 21.2 - Prob. 1CCCh. 21.2 - Explain the advantage of the systems biology...Ch. 21.2 - Prob. 3CCCh. 21.2 - MAKE CONNECTIONS In Concept 20.2, you learned...Ch. 21.3 - The best estimate is that the human genome...Ch. 21.3 - The Genomes Online Database (GOLD) Website of the...Ch. 21.3 - WHAT IF? What evolutionary processes might...Ch. 21.4 - Discuss the characteristics of mammalian genomes...Ch. 21.4 - VISUAL SKILLS Which of the three mechanisms...
Ch. 21.4 - Contrast the organizations of the rRNA gene family...Ch. 21.4 - MAKE CONNECTIONS Assign each DNA segment at the...Ch. 21.5 - Describe three examples of errors in cellular...Ch. 21.5 - Explain how multiple exons might have arisen in...Ch. 21.5 - What are three ways that transposable elements are...Ch. 21.5 - WHAT IF? In 2005, Icelandic scientists reported...Ch. 21.6 - Prob. 1CCCh. 21.6 - Prob. 2CCCh. 21.6 - Prob. 3CCCh. 21 - How did the Human Genome Project result in more...Ch. 21 - What has been the most significant finding of the...Ch. 21 - Compare genome size, gene number, and gene density...Ch. 21 - Explain how the function of transposable elements...Ch. 21 - How could chromosomal rearrangements lead to the...Ch. 21 - What type of Information can be obtained by...Ch. 21 - Bioinformatics intludes all of the following...Ch. 21 - Homeotic genes (A) encode transcription factors...Ch. 21 - Prob. 3TYUCh. 21 - DRAW IT Below are the amino acid sequences(using...Ch. 21 - EVOLUTION CONNECTION Genes important in the...Ch. 21 - scientific inquiry The scientists mapping the SNPs...Ch. 21 - Prob. 7TYUCh. 21 - SYNTHESIZE YOUR KNOWLEDGE Insects have three...
Knowledge Booster
Similar questions
- Pls help ASAParrow_forwardasap please A partially filled diagram of eukaryotic gene structure is shown below. Label the following additional elements in the empty boxes. One label must be used twice: a) 3'UTR, b) 5'UTR, c) exon, d) intron, e) promoterarrow_forwardQ1 There are similarities and differences during regulation of gene expression in both prokaryotes and eukaryotes. Promoters, transcription factors and RNA polymerase are essential elements in transcription but their properties and function may differ. b) Hypothesize the transcription of eukaryotic genes using prokaryotic promoter with further explanation.arrow_forward
- Solve all parts otherwise I will downvotearrow_forwardProject: You want to make a cat that glows in the dark (its nose, ears, and tail should glow). Choose the best answer. 9) To get started on this project, you isolate and cut out the gene in a jellyfish that codes for the green fluorescent protein (GFP). The next thing you need to do is attach this gene to the correct promoter so that you can be sure it is expressed appropriately in the cat. Which of the following promoters should you use? a) any promoter is fine b) the original promoter found in the jellyfish c) a promoter from a gene that is expressed in cells of the cat's nose, ears, and tail 10) You are now ready to transfer the piece of recombinant DNA you have prepared to the cat. You want to be sure that the transgenic cat you create will be able to pass the fluorescence on to its offspring. What is the best type of cell to transfer the recombinant DNA to? a) an unfertilized egg b) a fertilized egg c) somatic cells of an adult catarrow_forwardQ10. Does frame +2 have an ORF in the coding region of this exon? What about frame +1 and frame +3? Q11. Given that 3 of the 64 possible codons are stop codons, what is the chance of having a stop codon at any given position, assuming that the sequence is random?arrow_forward
- Need answer in short and ASAParrow_forwardHow is transcription different in eukaryotes compared to prokaryotes? Choose one: • Transcription occurs in the nucleus in eukaryotes and in the cytoplasm in prokaryotes. Eukaryotes transcribe both strands of DNA, while prokaryotes transcribe only one strand. Eukaryotes use RNA polymerase for transcription, while prokaryotes use ribosomes.arrow_forwardPls help ASAParrow_forward
arrow_back_ios
SEE MORE QUESTIONS
arrow_forward_ios
Recommended textbooks for you
Biology (MindTap Course List)BiologyISBN:9781337392938Author:Eldra Solomon, Charles Martin, Diana W. Martin, Linda R. BergPublisher:Cengage Learning
Biology: The Dynamic Science (MindTap Course List)BiologyISBN:9781305389892Author:Peter J. Russell, Paul E. Hertz, Beverly McMillanPublisher:Cengage Learning
Human Heredity: Principles and Issues (MindTap Co...BiologyISBN:9781305251052Author:Michael CummingsPublisher:Cengage Learning
Biology (MindTap Course List)
Biology
ISBN:9781337392938
Author:Eldra Solomon, Charles Martin, Diana W. Martin, Linda R. Berg
Publisher:Cengage Learning
Biology: The Dynamic Science (MindTap Course List)
Biology
ISBN:9781305389892
Author:Peter J. Russell, Paul E. Hertz, Beverly McMillan
Publisher:Cengage Learning
Human Heredity: Principles and Issues (MindTap Co...
Biology
ISBN:9781305251052
Author:Michael Cummings
Publisher:Cengage Learning