BIOLOGY-TEXT
5th Edition
ISBN: 9781260169621
Author: BROOKER
Publisher: MCG
expand_more
expand_more
format_list_bulleted
Textbook Question
Chapter 22.3, Problem 1CC
The Molecular Processes
Concept Check: Why do these orthologs have similar gene sequences? Why aren’t the sequences identical?
Expert Solution & Answer
Want to see the full answer?
Check out a sample textbook solutionStudents have asked these similar questions
Alignment of protein sequences from the HOx gene family identifies a highly conserved domain in the C-terminal part of the protein that is a
domain (one acronym and one word). Although Hox genes have important roles during embryogenesis and tissue
(one word) that are rich in the bases
(one word each). To ensure high affinity binding to
and
differentiation, the different HOX proteins bind to very similar DNA
(one acronym)
(one word). the HOX proteins form complexes with
(two words).
and specific regulation of target
A Moving to another question will save this response.
K Question 12 of 15
Genetics of man question:Describe the molecular genetics analysis for the GATA binding protein gene and consider the possibility of lethality and functional
redundancy and experimental strategies to address possibilities.
Q10. Does frame +2 have an ORF in the coding region of this exon? What about frame +1 and frame +3?
Q11. Given that 3 of the 64 possible codons are stop codons, what is the chance of having a stop codon at any given position, assuming that the sequence is random?
Chapter 22 Solutions
BIOLOGY-TEXT
Ch. 22.1 - Prob. 1CCCh. 22.1 - Overview of Evolution Experimental Questions What...Ch. 22.1 - Overview of Evolution Experimental Questions...Ch. 22.1 - Overview of Evolution Experimental Questions...Ch. 22.2 - Prob. 1CSCh. 22.2 - Prob. 1CCCh. 22.2 - Prob. 2CCCh. 22.2 - Prob. 3CCCh. 22.3 - The Molecular Processes Concept Check: Why do...Ch. 22.3 - Prob. 1CS
Ch. 22.3 - Prob. 2CCCh. 22 - Prob. 1TYCh. 22 - Lamarcks vision of evolution differed from Darwins...Ch. 22 - Which of the following scientists influenced...Ch. 22 - Prob. 4TYCh. 22 - Vestigial structures are anatomical structures a....Ch. 22 - Which of the following is an example of a...Ch. 22 - Prob. 7TYCh. 22 - Prob. 8TYCh. 22 - Prob. 9TYCh. 22 - Prob. 10TYCh. 22 - Evolution that results in adaptation is rooted in...Ch. 22 - What is convergent evolution? How does it support...Ch. 22 - Prob. 3CQCh. 22 - Prob. 1COQCh. 22 - Prob. 2COQ
Knowledge Booster
Learn more about
Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.Similar questions
- Question: Explain how epigenetic marks and genomic imprinting are related. Provide a drawing to illustrate your point.arrow_forwardGenetics of man question: Provide a brief description of on the SNP for the gene GATA binding protein 3 (GATA3)and as well as the gene .arrow_forwardHELP PLEASE !! In moelcular genetics, initiation is often accomplished using proteins that prevent elongation. Name and describe 3 processes where this happens, they can be in different species. Make sure to name or describe the proteins and substrates involved and how the elongation inhibition is overcome.arrow_forward
- WHAT IF? DRAW IT The template strand of a geneincludes this sequence:3¿-TACTTGTCCGATATC-5¿. It is mutated to3¿-TACTTGTCCAATATC-5¿. For both wild-type and mutantsequences, draw the double-stranded DNA, the resultingmRNA, and the amino acid sequence each encodes. Whatis the effect of the mutation on the amino acid sequence?arrow_forwardconstruct! Which of the four constructs (Construct 1-4) below could you use to make your own mouse knockout? For each one you did not choose, explain why you did not choose that construct. Part of DHCR7 gene structure is shown on top row in the schematic. (Antibiotic selection and negative selection genes have been abbreviated.) Gene DHCR7 Intron 1 Exon 2 Intron 2 Exon 3 Exon1 Construct #1 Construct #2 Intron1 Negative Sel. Intron1 |Antibio. Sel. Negative Sel. Intron2 Antibio. Sel Intron 2 Construct #3 Construct #4 Introni Antibio. Sel Negative Sel. Negative Sel. Antibio. Sel. Intron2 Intron1 Intron2arrow_forwardWhich statements are true? Explain why or why not.1 Each member of the human hemoglobin genefamily, which consists of seven genes arranged in two clus-ters on different chromosomes, is an ortholog to all of theother members.2 Horizontal gene transfer is more prevalent in sin-gle-celled organisms than in multicellular organisms.3 Most of the DNA sequences in a bacterial genomecode for proteins, whereas most of the DNA sequences inthe human genome do not.arrow_forward
- Alignment of protein sequences from the HOX gene family identifies a highly conserved domain in the C-terminal part of the protein that is a domain (one acronym and one word). Although Hox genes have important roles during embryogenesis and tissue differentiation, the different HOX proteins bind to very similar DNA (one word) that are rich in the bases and (one word each). To ensure high affinity binding to (one acronym) and specific regulation of target (one word), the HOX proteins form complexes with (two words).arrow_forwardRecall from the central dogma that DNA codes for mRNA, which then codes for protein. Also recall that directionality matters! DNA 3' TAC - CTA -AAT - TGC - TCG-ATT 5' mRNA 5' ???- ???- ???- ???- ???- ??? 3' protein ? ? ? ? ? (A) Indicate whether the DNA sequence provided is the sense strand or the antisense strand. ? that (B) For the DNA sequence given above, write out the mRNA sequence that results. (C) Now write the amino acid sequence that results from the mRNA sequence you wrote in part (B). Use the three-letter abbreviations for the amino acids. (D) What happens if the A that is bolded and underlined in the given DNA sequence is mutated (changed) to a C? How is the protein affected? This can be answered in a few words, but be specific! (E) Now let's pretend for a moment that the protein being affected is ATP-ADP translocase. What, if anything, would happen to the citric acid cycle? This should be answered in a few words/one sentence max.arrow_forwardPlease answer fast Explain how you would go about developing new ribozymes capable of targeting new sequences and that can be controlled using effector molecules of your choosing.arrow_forward
- GTTTTCACTGGCGAGCGTCATCTTCCTACT 1. Identify the gene from which the query sequence originates (Name of the gene)2. Provide the FULL protein sequence encoded by the gene.3. Are different splice variants known for this gene?4. What human disease has been connected to this gene?5. Calculate molecular weight (kiloDalton, kD) and calculated pI (the pH where theprotein carries no net electrical charge) of the protein.6. Provide the reference (in proper reference form: Author; Year; Title; JournalName; Volume; Page Numbers) for a recent publication involving the identifiedgene. This reference should NOT be a web page reference.7. Are there homologs for the identified gene in other systems? Identify one homolog in an invertebrate system (if there is none, provide a vertebratehomolog).8. What is the function (e.g. transcriptional regulation, transmembrane signaling,kinase, protease, etc.) of the protein(s) encoded by the gene.9. Generate a FULL protein sequence alignment for one of the…arrow_forwardHunt essay What was so radical about Hunt’s proposal regarding the mechanism of cyclin disappearance?arrow_forwardGenetics of man question:Provide the expression pattern of the gene ,GATA binding 3 (GATA3).arrow_forward
arrow_back_ios
SEE MORE QUESTIONS
arrow_forward_ios
Recommended textbooks for you
- Biology: The Dynamic Science (MindTap Course List)BiologyISBN:9781305389892Author:Peter J. Russell, Paul E. Hertz, Beverly McMillanPublisher:Cengage LearningHuman Heredity: Principles and Issues (MindTap Co...BiologyISBN:9781305251052Author:Michael CummingsPublisher:Cengage Learning
Biology: The Dynamic Science (MindTap Course List)
Biology
ISBN:9781305389892
Author:Peter J. Russell, Paul E. Hertz, Beverly McMillan
Publisher:Cengage Learning
Human Heredity: Principles and Issues (MindTap Co...
Biology
ISBN:9781305251052
Author:Michael Cummings
Publisher:Cengage Learning
What are Mutations and what are the different types of Mutations?; Author: Science ABC;https://www.youtube.com/watch?v=I16YlE8qTBU;License: Standard youtube license