PRESCOTTS GENERAL MICROBIOLOGY
11th Edition
ISBN: 9781307412420
Author: WILLEY
Publisher: MCG/CREATE
expand_more
expand_more
format_list_bulleted
Videos
Question
Chapter 23, Problem 3AL
Summary Introduction
The genus Streptomyces is classified under the order of Streptomycetales. Chains of spores (3 to 50) or even more exospores are produced by these bacteria. These bacteria are of high importance in medicine because they produce antibiotics, antifungal and anticancer agents.
Expert Solution & Answer
Want to see the full answer?
Check out a sample textbook solution
Students have asked these similar questions
a. Mycobacteriophage genes occasionally begin with GUG or, even more rarely , UUG (rather than AUG ). Which amino acids corre spond to these codons ? b. Yeast genes occasionally begin with CUG, ACG , or AUC . Which amino acids correspond to these codons ?
Eukaryotes modify mRNA with an m7G cap: an N7-methylated guanosine linked via a 5′ to 5′ triphosphate linkage, and by methylation at the 2'-hydroxyl of the penultimate nucleoside. What cofactors involved in the capping reaction
Order the following choices to indicate the sequence of steps in the process of elongation of agrowing peptide chain. a. release of EF1-GDPb. EF2-GTP hydrolysis promotes translocation of the ribosomec. peptidyltransferase reaction catalyzed by large rRNA subunitd. aminoacyl-tRNA binds the ribosomal A site via EF1-GTP hydrolysis
Chapter 23 Solutions
PRESCOTTS GENERAL MICROBIOLOGY
Ch. 23.1 - MICRO INQUIRY Refer to table 24.2 and determine...Ch. 23.1 - MICRO INQUIRY Why do Mycobacterium spp. have...Ch. 23.1 - Prob. 3MICh. 23.1 - Prob. 1.1CCCh. 23.1 - Prob. 1.2CCCh. 23.1 - Retrieve, Infer, Apply Why are actinobacteria of...Ch. 23.1 - Prob. 1.4CCCh. 23.1 - Retrieve, Infer, Apply Compare the morphology and...Ch. 23.1 - Prob. 1.6CCCh. 23.1 - Prob. 1.7CC
Ch. 23.1 - Prob. 1.8CCCh. 23.1 - Retrieve, Infer, Apply List the distinguishing...Ch. 23.1 - Prob. 2.2CCCh. 23.1 - Prob. 2.3CCCh. 23.1 - Retrieve, Infer, Apply Describe three ways in...Ch. 23.1 - Briefly describe the defining properties of genera...Ch. 23.1 - Prob. 2.6CCCh. 23.1 - Examine the ingredients list on a commercial...Ch. 23.2 - What growth or survival advantage might this type...Ch. 23.2 - What is the net yield of ATP for each glucose that...Ch. 23.2 - Prob. 3MICh. 23.2 - Prob. 1CCCh. 23.2 - Prob. 2CCCh. 23.2 - Prob. 3CCCh. 23.2 - Prob. 4CCCh. 23.2 - How are various species of Streptococcus...Ch. 23.2 - Of what practical importance are leuconostocs?...Ch. 23.2 - What is the difference between -hemolysis and...Ch. 23.3 - The presence of an electron transport chain in a...Ch. 23.3 - In addition to its Gram-staining characteristics,...Ch. 23.3 - What are the two sources of electrons for the H....Ch. 23.4 - Prob. 1CCCh. 23.4 - Suggest why C. tetani uses a sodium motive force...Ch. 23.4 - Prob. 3CCCh. 23.4 - What kind of genetic evidence, in addition to 16S...Ch. 23 - Prob. 1RCCh. 23 - Prob. 2RCCh. 23 - Prob. 3RCCh. 23 - Prob. 4RCCh. 23 - Prob. 5RCCh. 23 - Prob. 6RCCh. 23 - Prob. 7RCCh. 23 - Prob. 8RCCh. 23 - Prob. 9RCCh. 23 - Prob. 10RCCh. 23 - Even though actinobacteria are high G + C...Ch. 23 - Given that mycolic acids are essential for...Ch. 23 - Prob. 3ALCh. 23 - Prob. 4ALCh. 23 - Prob. 5ALCh. 23 - What physiological properties might account for...Ch. 23 - S. aureus strains that are resistant to...Ch. 23 - Prob. 8AL
Knowledge Booster
Learn more about
Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.Similar questions
- explain RNA editing in trypanosomesarrow_forwardIn Plasmodium, describe the processing of lysyl-tRNA synthetase transcript, by including the localization within the cell, any processing and packaging in general. Any particles that bind to the mRNA molecules, exchange, any membrane to cross, any functional groups to be addedarrow_forwardDescribe how an Rna molecule is translated into a protein at the ribosome In 4 simple bullet points pleasearrow_forward
- The following is a sequence of the leader region ofthe his operon mRNA in Salmonella typhimurium.What bases in this sequence could cause a ribosometo pause when histidine is limiting (that is, when thereis very little of it) in the medium?5′ AUGACACGCGUUCAAUUUAAACACCACCAUCAUCACCAUCAUCCUGACUAGUCUUUCAGGC 3′arrow_forwardDescribe RNA editing in trypanosomes.arrow_forwardThe figure below shows the introns and exons found in gene X. The size of each exon and intron is shown as well. A study on this organism found that two mature mRNA molecules are produced for this gene. One is 457 nucleotides in length, and the other is 439 nucleotides in length. Name the process responsible for producing this variation. Also explain how these 457 and 439 nucleotide fragments were produced by referring to the information provided. Hint: This organism produces a poly-A tail of 120 nucleotides.arrow_forward
- What process would be affected by the lack of the en- zyme RNA polymerase?arrow_forwardExplain the mechanism by which the fungal toxin brefeldin A affects retrieval of KDEL-tagged proteins from the cis-Golgi network back to the endoplasmic reticulum.arrow_forwardHow can ribosomes cause problems in treacher collins Syndrome? Please write it in a summarized/simple way. And include it in bullet points. Thank you so mucharrow_forward
- Contrast the functions of Spo11 and Cas9, twoenzymes that catalyze the formation of doublestrand breaksarrow_forwardComplete the following table: Type of RNA Functions Transfer RNA (tRNA) In a ribosome, plays a structural role;as a ribozyme, plays a catalytic role(catalyzes peptide bond formation) Primary transcript Small RNAs in the spliceosomearrow_forwardThree different chitin synthase genes control chitin synthesis in S. cerevisiae. Discuss what will happen to the budding yeast if a mutation occurs in each of the genes below: CHSI CHSII CHSIIIarrow_forward
arrow_back_ios
SEE MORE QUESTIONS
arrow_forward_ios
Recommended textbooks for you
Human Heredity: Principles and Issues (MindTap Co...BiologyISBN:9781305251052Author:Michael CummingsPublisher:Cengage Learning
Human Heredity: Principles and Issues (MindTap Co...
Biology
ISBN:9781305251052
Author:Michael Cummings
Publisher:Cengage Learning
Cell Differentiation | Genetics | Biology | FuseSchool; Author: FuseSchool - Global Education;https://www.youtube.com/watch?v=gwAz_BtVuLA;License: Standard YouTube License, CC-BY