BIOLOGY-TEXT
5th Edition
ISBN: 9781260169621
Author: BROOKER
Publisher: MCG
expand_more
expand_more
format_list_bulleted
Concept explainers
Question
Chapter 23.4, Problem 1CS
Summary Introduction
To determine: The three different genetic changes that one would expect to be neutral with reference to the genetic code described in table 12.1 given in the text book.
Introduction: The genetic code can be defined as a particular set of rules that is used by the living organisms for translating the given information encoded within the sequences of genetic material into the functional proteins.
Expert Solution & Answer
Want to see the full answer?
Check out a sample textbook solutionStudents have asked these similar questions
Bioinformatics:
Explore the applications of bioinformatics in genomics research. How do computational methods contribute to understanding genetic variations and their implications for personalized medicine?
Objective: Get a sense of how genomics, the study of the genome in its entirety,needs to think about how to go about its research.
Geonomic DNA is broken up into fragments. The 5’ and 3’ ends of each fragment(a “read”) are sequenced. The sequenced reads are assembled together intocontiguous sequences (“contigs”) based on sequence similarity.
The idea is to sequence enough random fragments so that every nucleotide in thegenome is represented on some read. The number of such fragments needed iscalled the coverage, c.
The coverage c can be calculated by the formula RL/G, where R is the number ofreads sequenced, L is the average length of a read and G is the total length of thegenome. The units of length are bases (b) or base pairs (bp).
Consider a genome whose length is 1000 bp. “Shotgun” sequencing techniquesare applied to the genome, resulting in 20 reads, with an average length of 50 bp.A very important point is that, even though 20 x 50 = 1000, there is no guaranteethat ALL…
Objective: Get a sense of how genomics, the study of the genome in its entirety,needs to think about how to go about its research.
Geonomic DNA is broken up into fragments. The 5’ and 3’ ends of each fragment(a “read”) are sequenced. The sequenced reads are assembled together intocontiguous sequences (“contigs”) based on sequence similarity.
The idea is to sequence enough random fragments so that every nucleotide in thegenome is represented on some read. The number of such fragments needed iscalled the coverage, c.
The coverage c can be calculated by the formula RL/G, where R is the number ofreads sequenced, L is the average length of a read and G is the total length of thegenome. The units of length are bases (b) or base pairs (bp).
Consider a genome whose length is 1000 bp. “Shotgun” sequencing techniquesare applied to the genome, resulting in 20 reads, with an average length of 50 bp.A very important point is that, even though 20 x 50 = 1000, there is no guaranteethat ALL…
Chapter 23 Solutions
BIOLOGY-TEXT
Ch. 23.1 - Prob. 1CSCh. 23.2 - Prob. 1CCCh. 23.2 - Prob. 2CCCh. 23.2 - Prob. 3CCCh. 23.3 - Prob. 1CCCh. 23.3 - Prob. 1EQCh. 23.3 - Prob. 2EQCh. 23.3 - Prob. 3EQCh. 23.4 - Genetic Drift Concept Check: How does the...Ch. 23.4 - Prob. 1CS
Ch. 23.5 - Prob. 1CCCh. 23 - Population geneticists are interested in the...Ch. 23 - The Hardy-Weinberg equation characterizes the...Ch. 23 - Prob. 3TYCh. 23 - Prob. 4TYCh. 23 - Prob. 5TYCh. 23 - Prob. 6TYCh. 23 - Prob. 7TYCh. 23 - Prob. 8TYCh. 23 - Kimuras proposal regarding neutral variation...Ch. 23 - Populations that experience inbreeding may also...Ch. 23 - Prob. 1CQCh. 23 - Prob. 2CQCh. 23 - Prob. 3CQCh. 23 - Antibiotics are commonly used to combat bacterial...Ch. 23 - Discuss die similarities and differences among...
Knowledge Booster
Learn more about
Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.Similar questions
- When performing contract relax (CR) stretching, how many times can the sequences be repeated?arrow_forwardU Introduction to Bioinformatics Midterm AA 18- Protein sequences can be more informative than DNA sequences. Which of the following is NOT one of the reasons? a) Most of the changes in a DNA sequence do not change the amino acid that is specified. b) Protein sequences can provide information on SNPs and differences between individuals that are not translated. sequences. uskudar-sinav-Ims.almscloud.net c) Many amino acids share related biophysical properties and these relationships in an alignment can be used for scoring systems. d) There are 20 characters (amino acids) in a protein sequence whereas DNA has 4 characters (nucleotide bases). e) Protein sequences offer a longer look-back time than DNA Leave blank Closearrow_forwardDescribe your amplicon based on molecular size. Comparing the size of the genomic DNA Describe your amplicon based on molecular size. Comparing the size of the genomic DNA (as seen in Fig. 8.1) and the PCR products based on band position in the gel (as seen in Fig. 8.2).arrow_forward
- help. Select all that are true 1- traditional' (as nicknamed from the last 70-8- years) and organic farming are the same. 2- GOMs may involve including a gene from a completely unrelated organism, such as agene from a jelly fish into amonkey. 3- Traditional'( as nicknamed from the last 70-80 years) and GOM farming generally include the use of pesticides and herbicides 4-Organic food may not include genetics modifications, pesticides, or herbicides.arrow_forwardNeed help 1) Say you have an organism with a genome of 1 thousand bases (103) and a forward primer made up of 5 nucleotides (aka, a 5-mer) a)How many possible 5-mers are there? Remember that each position in the 5-mer has one of four nucleotides. b) Pick a 5-nucleotide position at random in the genome: what’s the probability that your forward primer matches there? Focus for now just on one strand of DNA. c) Pick a random 5-nucleotide position in the genome: what’s the probability that your forward primer does NOT match there? Focus for now just on one strand of DNA. d) How many physical locations might your forward primer sit in the genome? Focus just on one strand of DNA. Ignore whether or not it matches at a given location. this is one question with different parts. I would really appreciate it if all parts are answered. and I will defiantly rate.arrow_forwardProvide five advantages of Next Generation Sequencing? and explain each of these advantages.arrow_forward
- Analyzing Cloned Sequences What kind of information can a DNA sequence provide to a researcher studying a disease-causing gene?arrow_forwardHome Work: • Suppose you perform a PCR that begins with one double-strand of the following DNA template: +5' -СТАССТСCGGGTTGACTGСТАССТТССССGGATGCCCAAAAТТСТСGAG-3— :::::::::::: :::::::::::: :::: +3'-GATGGACССССААСТGACGATGGAAGGGCCCТАССGGTTTTAAGAGCTC-5'+ A. Draw one cycle of PCR reaction below the following diagram. B. Label the template DNA, the primers, and what is happening at each step. (1) température cycle #1arrow_forwardProtein Synthesis and Mutation Practice • Complete the lines below by determining the mRNA transcript and amino acid sequence. • Compare the mutant DNA strands to the wild type strand. ⚫ Circle the mutation in the mutant DNA strands and describe the type of mutation (frameshift - insertion, frameshift - deletion, point - missense, point - silent, or point-nonsense). Not all of these will be used in this assignment! Wild type DNA template: 3' TACGCGTGCACGATGCAGTAGTACATC5' mRNA transcript sequence: Amino acid sequence: Mutation #1 DNA template: 3' TACGCGTGCACGATCCAGTAGTACATC5' mRNA transcript sequence: Amino acid sequence: Type of mutation: Mutation #2 DNA template: 3' TACGCGTGCTCGATGCAGTAGTACATC5' mRNA transcript sequence: Amino acid sequence: Type of mutation:arrow_forward
- Recombination in Sexually and asexually Reproducing Organisms ASSIGNMENT 1. What is the importance of Gregor Mendel's Law of Inheritance in Molecular Biology? 2. What is the importance of Recombinant DNA Technology in the Molecular Laboratory? 3. Describe how DNA moves from cell to cell by: a. conjugation b. transduction c. transformationarrow_forwardExplain Shortly. I need help The emergence of new molecular biology techniques has allowed researchers to determine DNA sequences quickly and efficiently. A) How could knowledge of a DNA sequence be abused? B) How could knowing a DNA sequence be helpful? C) Would you ever consent to having your DNA sequenced. Explain your answerarrow_forwardWhat are the pros and cons of genetic engineering. Give at least 3 each and share your opinions whether you are pro or against genetic engineering, and support these opinions with facts. Be sure that issues of biosafety are included in the discussion.arrow_forward
arrow_back_ios
SEE MORE QUESTIONS
arrow_forward_ios
Recommended textbooks for you
- Biology: The Dynamic Science (MindTap Course List)BiologyISBN:9781305389892Author:Peter J. Russell, Paul E. Hertz, Beverly McMillanPublisher:Cengage LearningHuman Heredity: Principles and Issues (MindTap Co...BiologyISBN:9781305251052Author:Michael CummingsPublisher:Cengage Learning
Biology: The Dynamic Science (MindTap Course List)
Biology
ISBN:9781305389892
Author:Peter J. Russell, Paul E. Hertz, Beverly McMillan
Publisher:Cengage Learning
Human Heredity: Principles and Issues (MindTap Co...
Biology
ISBN:9781305251052
Author:Michael Cummings
Publisher:Cengage Learning
QCE Biology: Introduction to Gene Expression; Author: Atomi;https://www.youtube.com/watch?v=a7hydUtCIJk;License: Standard YouTube License, CC-BY