Concept explainers
Interpretation:
The severity of DNA mutation that produced in the following changes in mRNA codons has to be compared.
Concept Introduction:
Mutation: Mutation is the error occurred in the base sequence of a DNA which is passed along when
Codons are the sequence of three bases in mRNA that specifies the amino acid to be incorporated into a protein.
Some amino acids and their corresponding mRNA codons are listed below,
Start codon is a codon that specifies the start of RNA translation.
Stop codon is a codon that specifies the end of RNA translation. There are mainly three stop codons UGA, UAA and UAG.
Want to see the full answer?
Check out a sample textbook solutionChapter 27 Solutions
FUND.OF GEN,ORG.+...-MOD.ACCESS>CUSTOM<
- Briefly describe the function of the following in protein synthesis. a. rRNA b. tRNA c. mRNAarrow_forwardGiven the following tRNA anticodon sequence, derive the mRNA and the DNA template strand. Also, write out the amino acid sequence of the protein encoded by this message. tRNA: UAC UCU CGA GGC mRNA: protein: How many hydrogen bonds would be present in the DNA segment?arrow_forwardIf an extra nucleotide is inserted in the first exon of the beta globin gene, what effect will it have on the amino acid sequence of the globin polypeptides? Will the globin most likely be fully functional, partly functional, or nonfunctional? Why?arrow_forward
- An mRNA has the following base sequence:5′–CAGGCGGCGAUGGACAAUAAAGCGGGCCUGUAAGC–3′Identify the start codon, and determine the complete amino acid sequence that will be translated from this mRNA.arrow_forwardExplain the steps of RNA translation into protein. Mutations: The codon GGA encodes the amino acid glycine. Identify the type of mutation for each of the following changes (name both the type of mutation and what the new codon would produce): GGA to GGG GGA to UGA GGA to GAGA GGA to AGAarrow_forwardFor each of the following mRNA sequences predict the appropriate protein sequence:a. AUGCGCCCCCAGUGACCACACb. AUGACAUGUGUAAACc. AUGAUAUCUAGACAAarrow_forward
- An mRNA has the following sequence: 5′–CAGGCGGCGAUGGACAAUAAAGCGGGCCUGUAAGC–3′ Identify the start codon, and determine the complete amino acid sequence that will be translated from this mRNA.arrow_forwardFor the codon sequence : 5’ GGA – AUA – UGG – UUC – CUA – 3’ Write the Amino acid sequence produced in each of the following ways: Translation proceeds in a normal manner A mutation changes GGA to GGG A mutation changes GGA to CGAarrow_forwardIf there are 64 possible codons in the genetic code and the amino acid is specified by each, as read in the 5’ to 3’ direction from the mRNA sequence, which ones are STOP codons?arrow_forward
- Given the following mRNA sequence, write the peptide sequence that will result from protein translation. Please indicate the correct directionality.arrow_forwardGiven the following mRNA sequence: 5-AUCCCGUAUGCCCGGGAGCUAGCCCAGC-3 a) Label the first condon, the stop codon, the untranslated regions and predict the amino acid sequence of the polypeptidarrow_forwardIndicate the amino acids that would appear in the protein produced by translation of this mRNA sequencearrow_forward
- Human Heredity: Principles and Issues (MindTap Co...BiologyISBN:9781305251052Author:Michael CummingsPublisher:Cengage LearningBiology Today and Tomorrow without Physiology (Mi...BiologyISBN:9781305117396Author:Cecie Starr, Christine Evers, Lisa StarrPublisher:Cengage LearningBiology (MindTap Course List)BiologyISBN:9781337392938Author:Eldra Solomon, Charles Martin, Diana W. Martin, Linda R. BergPublisher:Cengage Learning