EBK CAMPBELL BIOLOGY
11th Edition
ISBN: 8220103613828
Author: Reece
Publisher: PEARSON
expand_more
expand_more
format_list_bulleted
Concept explainers
Textbook Question
Chapter 28.3, Problem 2CC
WHAT IF? Ø Would you expect the plastid DNA of photosynthetic dinoflagellates, diatoms, and golden algae to be more similar to the nuclear DNA of plants (domain Eukarya) or to the chromosomal DNA of cyanobacteria (domain Bacteria)? Explain.
Expert Solution & Answer
Want to see the full answer?
Check out a sample textbook solutionStudents have asked these similar questions
(a) Explain why the term " junk dna" may not be such an accurate description?
(b) provide 1 similarity and 1 difference between the structure of individual genes of eukaroyotes and prokayotes
Classifiation of Llfe
A new organism was discovered in a deep sea vent at the bottom of the
ocean. The researchers collected the sample and made careful
observations of it. The picture at right shows a microscopic image
captured at 1000X its actual size.
Below are some other observations made:
• When DNA was isolated from the cell, it was mixed with an equal
portion of histone proteins
• There are no visible organelles present inside the cell
• The specimen seem to die in the presence of oxygen
• Able to live in conditions that mimic deep sea vents without any
external food source provided
Based on these observations, determine each of the following and
provide a clear rationale.
A) To which domain would you assign this organism? Why?
B) Propose a hypothesis of how they obtain nutrients. Are these most
likely autotrophs or heterotrophs? Provide a rationale.
Choose the CORRECT order of compaction of DNA in eukaryotes.
DNA → nucleosome → loops → fiber → "beads on a string" →
chromosome
DNA → nucleosome → "beads on a string" → fiber → loops →
chromosome
DNA → nucleosome → fiber → loops → "beads on a string" →
chromosome
DNA → "beads on a string" → fiber → nucleosome → loops →
chromosome
DNA → fiber → loops → nucleosome → "beads on a string" →
chromosome
Chapter 28 Solutions
EBK CAMPBELL BIOLOGY
Ch. 28.1 - Cite at least four examples of structural and...Ch. 28.1 - Summarize the role of endosymbiosis in eukaryotic...Ch. 28.1 - Prob. 3CCCh. 28.2 - Why do some biologists describe the mitochondria...Ch. 28.2 - WHAT IF? DNA sequence data for a diplomonad, a...Ch. 28.3 - Explain why forams have such a well-preserved...Ch. 28.3 - WHAT IF? Would you expect the plastid DNA of...Ch. 28.3 - Prob. 3CCCh. 28.3 - Prob. 4CCCh. 28.4 - Contrast red algae and brown algae.
Ch. 28.4 - Why is it accurate to say that Ulva is truly...Ch. 28.4 - Prob. 3CCCh. 28.5 - Contrast the pseudopodia of amoebozoans and...Ch. 28.5 - Prob. 2CCCh. 28.5 - Prob. 3CCCh. 28.6 - Justify the claim that photosynthetic protists are...Ch. 28.6 - Prob. 2CCCh. 28.6 - WHAT IF? High water temperatures and pollution...Ch. 28.6 - MAKE CONNECTIONS The bacterium Wolbachia is a...Ch. 28 - Describe similarities and differences between...Ch. 28 - What evidence indicates that the excavates form a...Ch. 28 - Prob. 28.3CRCh. 28 - On what basis do systematists place plants in the...Ch. 28 - Describe a key feature for each of the main...Ch. 28 - Prob. 28.6CRCh. 28 - Plastids that are Surrounded by more than two...Ch. 28 - Biologists think that endosymbiosis gave rise to...Ch. 28 - Prob. 3TYUCh. 28 - According to the phylogeny presented in this...Ch. 28 - In a life cycle with alternation of generations,...Ch. 28 - Based on the phylogenetic tree in Figure 28.2,...Ch. 28 - Prob. 7TYUCh. 28 - SCIENTIFIC INQUIRY Applying the If then logic of...Ch. 28 - WRITE ABOUT A THEME: INTERACTIONS Organisms...Ch. 28 - SYNTHESIZE YOUR KNOWLEDGE This micrograph show's a...
Knowledge Booster
Learn more about
Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.Similar questions
- A major difference between hereditary information in eukaryotes and prokaryotes is: a. in prokaryotes, the hereditary information is distributed among individual, linear DNA molecules in the nucleus. b. in eukaryotes, the hereditary information is encoded in a single, circular DNA molecule. c. in prokaryotes, the hereditary information is usually distributed among multiple circular DNA molecules in the cytoplasm. d. in eukaryotes, the hereditary information is distributed among individual, linear DNA molecules in the cytoplasm. e. in eukaryotes, the hereditary information is distributed amoung individual, linear DNA molecules in the nucleus.arrow_forwardMatch the following terms with their descriptions:Heredity (a) Threadlike molecule of DNA,Chromosome typically circular in prokaryotesPhenotype (b) Permanent alteration in DNAGene (c) Involves the transmission ofAlleles information from an organismMutation to its progenyGenotype (d) Refers to the genetic informa- tion contained in the DNA of an organism (what it actually is) (e) The specific characteristics displayed by the organism (what it appears to be) (f) Linear sequence of DNA that carries coded instructions for…arrow_forward5. Molecular Evidence. Cytochrome c is a protein located in the mitochondria of cells involved with cellular respiration. Compare each organism's Cytochrome CDNA sequences with the ancestor cell and each other. Circle or highlight the differences (mutations) present in the cytochrome CDNA sequences from ancestor cell. ANCESTOR CELL A T T AG C G A CCAGTATA T C C TAC A A T C C G TCTAC T T CATTO ATTAGCG A CCA GT TT AT C CTACA ATC C C G T CTACTT CAT11 ATTAT c G AC C A GT TT AT CCT ACATT CC c G TATACTTC GT 14 АМОЕВА SPONGE EARTHWORM C T TAT C G A C c c G TT T ATC CTACA TT C C c GT CT A CTT CGT CTTAT Cc ccc CGTTTATCCTACTTTCCCGT CT A CTTCGT CT A AT c cccc c GT T T ATC CTACT TTCCC G T CT A CTT CGT CT A AT c c ccc c G T T T AT C CTA CTT T C C CATCTACTA CTA AT ccc c c c GT T TATCCTACT TT C C CAT GT AGTA TAAT Ccc c c c GT T T AT c CTACT TT C C CATCTACTAAGT SHARK LIZARD KANGAROO GT DOLPHIN GT СAT 6. Create a Venn Diagram to show the relatedness of these organisms. Start with the trait that is…arrow_forward
- Given what you know about the structure and functionof telomerase, provide a plausible model to explain howa species could exist with a combination of two differentrepeats (for example, TTAGGG and TTGTGG) on eachof their telomeresarrow_forwardBuild a 3D model of a DNA molecule:-3-dimensional built structure -Contain sugar-phosphate backbones (constructed as separate molecules) -Contain nitrogenous bases (paired clearly and correctly) -Have a minimum of 10 base-pairs (minimum of 10 “rungs” or “steps” on the ladder) with the correct number of hydrogen bonds illustrated between each of the base pairs. -Have the orientation labeled on each strand and make sure the two strands are antiparallel.arrow_forward1- A genetic analysis of a bacterium reveals the presence of viral DNA. The most probable way this happened was through (a)mutation (b) conjugation (c)transduction (d)transposons (e)transformation 2- Which statemere is tobe regarding GEMC (a)typical cloning vectors involbe plasmids and viruses (b)eukaryotic genes may only be introduced and expressed in eukaryotic microbes such as yeasts (c)horizontal gene transfer methods may be manipulated to introduce new genes (d) expressions of introduced genes can be monitored through the use of marker genes. (e)it is possible for multiple genes may be added to microbes from other sources . plz give answer for both questions asap pleasearrow_forward
- BONUS: Why do RNA viruses such as the COVID coronavirus, influenza virus and HIV have much higher mutation rates than DNA viruses such as Herpes viruses? O DNA polymerases which copy viral RNA have much higher mutation rates than RNA polymerases which copy viral DNA O RNA polymerases which copy viral RNA have much higher mutation rates than DNA polymerases which copy viral DNA RNA viral 60S ribosomes make many ore mutations than DNA viral 40S ribosomes O RNA viral gyrases make more mistakes than DNA viral helicasesarrow_forwardMolecular Biology Cytochrome c is a protein found in mitochondria. It is used in the study of evolutionary relationships because most animals have this protein. Cytochrome c is made of 104 amino acids joined together. Below is a list of the amino acids in part of a cytochrome protein molecule for 9 different animals. Any sequences exactly the same for all animals have been skipped. For each non-human animal, take a highlighter and mark any amino acids that are different than the human sequence. When you finish, record how many differences you found in the table on the next page. 42 43 44 46 47 49 50 53 54 55 56 57 Human A Y S T. А K N G Chicken Q A E S T. K K G Horse A P D K N K G Tuna Q E F Frog A А S D K N K G Shark A Q T. D K S K Turtle Q A E F K N K G Monkey Q А Y T. K Rabbit Q А V F D K N K G 58 60 61 62 63 64 65 66 100 101 102 103 104 Human G E D M E K A T N E Chicken G E D M D A Horse T K E E T L M E K A T N E Tuna V E T L R E K Frog T. G E T L M E S A K Shark Q E L R K A A…arrow_forwardMolecular Biology Cytochrome c is a protein found in mitochondria. It is used in the study of evolutionary relationships because most animals have this protein. Cytochrome c is made of 104 amino acids joined together. Below is a list of the amino acids in part of a cytochrome protein molecule for 9 different animals. Any sequences exactly the same for all animals have been skipped. For each non-human animal, take a highlighter and mark any amino acids that are different than the human sequence. When you finish, record how many differences you found in the table on the next page. 42 43 44 46 47 49 50 53 54 55 56 57 Human Q A P Y S A K K Chicken A E F D K N K Horse Tuna Q A A F K K K K Q Frog A A F S D K N K G Shark A Q F T. D K K G Turtle A E F S E K N. K G Monkey A P Y А K K G Rabbit Q A V F S T. K N K G 58 60 61 62 63 64 65 66 100 101 102 103 104 Human G E D L M K A N E Chicken G E T. M E D A K Horse Tuna K N E E M A N IN K Frog G E E T. L M E S A S K Shark E R K A A S Turtle G E E T.…arrow_forward
- Extinct Threatened 4-A comparison of DNA or protein sequences from different species can reveal evolutionary relationships. This assumption is based on the idea that the nucleotide or amino acid sequence of a particular gene or the protein it encodes, respectively, mutates at a similar rate in different individuals. However, remember that the rate of mutation alone does not determine how fast a DNA sequence will change. The effects of mutation on survival and reproductive success (natural selection), as well as the generation time of the organism, also play important roles in the overall rate of genetic change in a population. VOLENT Vulnerable (UCN 3.1 EX EW CR EN Why might a non-coding region of DNA be more reliable than a gene like Leptin for building phylogenies? (9)arrow_forward1. Chromosome type not exhibited by humans. * 2. Chromosome type with noticeably short p-arm. * 3. When is the chromosome maximally compacted? 4.The 3-molecule basic component of the DNA. 5. Formed by a sugar moiety and a nitrogenous base. 6. The nitrogenous base that is replaced by uracil in the RNA. * 7. The complementary base pair of adenine. * 8. The base pair with three hydrogen bonds. * 9. The term that describes the orientation of DNA strands in a DNA molecule. * 10. The term that refers to the spiral arrangement of the DNA.arrow_forwardGiven the fact that 1 fg of DNA = 9.78 * 105base pairs (on average), you can convert the amount of DNA per cell to the lengthof DNA in numbers of base pairs. (a) Calculate the number of basepairs of DNA in the haploid yeast genome. Express your answer inmillions of base pairs (Mb), a standard unit for expressing genomesize. Show your work. (b) How many base pairs per minute weresynthesized during the S phase of these yeast cells?arrow_forward
arrow_back_ios
SEE MORE QUESTIONS
arrow_forward_ios
Recommended textbooks for you
- Biology: The Dynamic Science (MindTap Course List)BiologyISBN:9781305389892Author:Peter J. Russell, Paul E. Hertz, Beverly McMillanPublisher:Cengage Learning
Biology: The Dynamic Science (MindTap Course List)
Biology
ISBN:9781305389892
Author:Peter J. Russell, Paul E. Hertz, Beverly McMillan
Publisher:Cengage Learning
Bacterial Genomics and Metagenomics; Author: Quadram Institute;https://www.youtube.com/watch?v=_6IdVTAFXoU;License: Standard youtube license