Concept explainers
Interpretation:
The
Concept introduction:
![Check Mark](/static/check-mark.png)
Answer to Problem 1P
Explanation of Solution
The 3’ end of messenger ribonucleic acid can complement the 5’ end of the deoxyribonucleic acid transcribed from it. The deoxyribonucleic acid sequence can be represented from 5’ to 3’ as follows.
The amino group end of the aminoalkanoic acid sequence can start from the primary AUG sequence ranging from the 5’ end.
This ends up in the subsequent organic compound sequence as follows:
The 3’ end of ribonucleic acid can complement the 5’ end of the deoxyribonucleic acid transcribed from it. The N-terminal aminoalkanoic acid sequence can begin from the primary AUG sequence ranging from the 5’ end.
Want to see more full solutions like this?
Chapter 29 Solutions
Biochemistry
- A fragment of bacterial DNA reads: 3’ -TACCTATAATCTCAATTGATAGAAGCACTCTAC- 5’ Assuming that this fragment is the template strand, what is the sequence of mRNA that would he transcribed? (Hint: Be sure to identify the initiation site.)arrow_forwardYou continue to study the expression of the hexose kinase gene and capture the following electron micrograph of the gene being expressed. MRNA 1 20 ORI 40 60 TTCGAGCTCTCGTCGTCGAGATACGCGATGATATTACTGGIAATATĞGGGATGCACTATC 5' 3' AAGCTCGAGAGCAGCAGCTCTATGCGCTACTATAATGACCA'NTATAÇCCCTACGTGATAG CACTATC promoter RNA polymerase ribosomearrow_forwardTemplate strand: 5' AATCATAACTCATTG 3' A. Write the CODING strand of this sequence, including the 5' and 3' end designations. B. Write the amino acid sequence coded by this mRNA. The start codon is the first codon in the sequence that codes for Met. First position (5'-end) U < G บบบ UUC phe UUA UUG CUU Couleu CUC Coc CUA CUG AUU AUG AUC ile GUU GUC GUA GUG Second position C UCU UCC UCA UCG val CCU co CCC CCA 000 CCG ACU ACC ACC AUA ACA thr AUA ACA AUG met ACG GCU GCC ser GCA GCG pro ala UAU ORD tyr UAC UAA Stop UAG Stop CAU CAC CAA CAG - AAU AAC www AAA 10 asn AAG 7 his GAU GAC GAA GAG gin }| lys asp glu UGU UGC cys UGA Stop UGG trp CGU C00 CGC CGA 000 CGG AGU AGC ACA AGA AGG GGU GGC GGA GGG Initiation Termination arg ser arg gly DUAL SUAU DUAU DUAG Third position (3-end)arrow_forward
- DNA 5' ATGGCTTCTCAATACTGCTTTGTTTTGGTT 3' template strand 3' TACCGAAGAGTTATGACGAAACAAAACCAA 5' coding strand Write down the sequence of nucleotides in a fragment of an m-RNA molecule that will be produced based on the information in the DNA fragment above (start with 5' and end with 3'). If you separate codons in MRNA with blank spaces, it will be easier to do the next step. MRNA: 5' Using a three-letter code for amino acids write the sequence of the first ten amino acids of the protein pectate lyase (refer to the table of 64 codons from a lecture or a textbook).arrow_forwardRNA Transcription, Translation, and Mutation Worksheet First, here is a strand of DNA. This strand contains both a gene and its promoter region. Circle the promoter region in blue, draw a yellow box around the TATA box, draw a green box around the start codon, and draw a red box around the stop codon: TATATATATTACGTTGCATACGCTCAACGGTCGAAACTGCATGGGCAC ATATATATAATGCAACGTATGCGAGTTGCCAGCTTTGACGTACCCG Now imagine this gene has been transcribed into RNA. What would that RNA strand look like? Before the above RNA strand can be translated, a few modifications must first take place (in eukaryotes). What are they? 1) 2) 3) Using a codon chart of your choice (one can be found here, or here) translate the above RNA transcript (assume no splicing took place). Write the three letter abbreviations for the amino acids in the image below: Now imagine that a mutation took place in the original strand of DNA (marked in red) TATATATATTACGTTGCATACCCTCAACGGTCGAAACTGCATG…arrow_forward5'-ATGCTGCGTGCATGGGATATAGGTAGCACACGTCC-3' 3'-TACGACGCACGTACCC TATATCC ATCGTGTGCAGG-5' (a) Assuming that transcription starts with the first C in the template strand, and continues to the end, what would be the sequence of the MRNA derived from this fragment? (b) Find the initiation and stop codons in this MRNA. (c) Would there be an effect on translation of changing the fourth T in the template strand to a C? If so, what effect?arrow_forward
- TRANSCRIPTION ein The DNA provided for your animal is one side of the double helix. DNA - MRNA 1. Transcribe the DNA strand into mRNA. Don't forget the special base pair ham AU rules for RNA! VERSION 2 TA Fuentes- 2. Translate the mRNA into an amino acid chain. Notice that this is broken into 1 i nucleotide sequences called CODONS. Use the codon chart to find the i correct amino acids. Remember, translation for each chain always starts with the amino acid methionine (Met) and ends with one of the stop codons (UGA, UAG, UAA). C G G C ity you Co deter y Fuentes- code DNA TAC TGG GGT GT C стс TAG CTA ATC TAC IG G AC G cCc ACC GGT ATG ΑΤΤ thousar ytakes And se MRNA d or create AA Turn in 1l tables DNA TAC CAT TAC C GT CCC TC G GT T AT C TAC AAC AGG CCT TT G GC T CCG ACT MRNA thesis nments AA to Sean Che comme DNA TAC TTG GT T CT C CT G тст ACA ACT TAC CAT CGA TTG GGG T G T TAG ATC S comm MRNA AA Decide if you want to illustrate a horse, coyote, or a cat - get the phenotype information from…arrow_forwardDNA: 5’-CTCTACTATAAACTCAATAGGTCC-3’ Draw a box around the sequence where RNA polymerase will bind to the DNA. What is this sequence called? Will transcription start at this sequence, to the left of this sequence (“upstream”) or, to the right of this sequence (“downstream”)? Draw a small arrow above the DNA strand where transcription will begin. Which DNA strand will RNA polymerase transcribe? Highlight this strand with your highlighter. (Hint: RNA pol is similar to DNA pol because it can only make new RNA in the 5’ to 3’ direction. Draw in an arrow to show the direction that RNA polymerase will move along the DNA strand.arrow_forwardmRNA sequence of A gene Write the amino acid sequence of the gene A. 5’ AAACUGUGACUGAACCUCAAACCCCAAACCAGCCCGAGGAGAACCACAUUCUCCCAGGGA CCCAGGGCGGGCCGUGACCCCUGCGGCGGAGAAGCCUUGGAUAUUUCCACUUCAGAAGCCUACUGGGGAAGGCUGAGGGGUCCCAGCUCCCCACGCUGGCUGCUGUGCAGAUGCUGGACGACAGAGCCAGGAGGGAGGCCGCCAAGAAGGAGAAGGUAGAGCAGAUCCUGGCAGAGUUCCAGCUGCAGGAGGAGGACCUGAAGAAGGUGAUGAGACGGAUGCAGAAGGAGAUGGACCGCGGCCUGAGGUAGAAGCCGCUGGGGCUUGGGGCU-3’arrow_forward
- Give typing answer with explanation and conclusion 5'ATTAGGAGGTGCGTTATGCAGGCATGTTACGTACGTACG,TAAGATAAGTACT3’ 3' TAATCCTCCACGCAATACGTCCGTACAATGCATGCATGCATTCTATTCATGA5’ In the above piece of double stranded DNA, how many potential translations start sites exist if an mRNA could be synthesized from any portion of this DNA? Indicate where they are in the DNA above and explain how you found this number.arrow_forwardAnalyzing mRNA Sequences 1. Analyze the following amino acid sequence and write down a potential mRNA sequence from which this sequence might have been translated. Use the codon table in your book to determine a possible mRNA sequence. Amino Acid Sequence 1: H,N*-Methionine-Valine-Histidine-Leucine- Threonine-Proline-Glutamic Acid-Glutamic Acid- COO 2. (a) Consider Amino Acid Sequence 2. How is Amino Acid Sequence 2 different from Amino Acid Sequence 1? Amino Acid Sequence 2: H,N*-Methionine-Valine-Histidine-Leucine- Threonine-Proline-Valine-Glutamic Acid-CO (b) Write a potential mRNA sequence for Amino Acid sequence 2, using the same codons for any given amino acid if it is present in both sequences.arrow_forwardRecall from the central dogma that DNA codes for mRNA, which then codes for protein. Also recall that directionality matters! DNA 3' TAC - CTA -AAT - TGC - TCG-ATT 5' mRNA 5' ???- ???- ???- ???- ???- ??? 3' protein ? ? ? ? ? (A) Indicate whether the DNA sequence provided is the sense strand or the antisense strand. ? that (B) For the DNA sequence given above, write out the mRNA sequence that results. (C) Now write the amino acid sequence that results from the mRNA sequence you wrote in part (B). Use the three-letter abbreviations for the amino acids. (D) What happens if the A that is bolded and underlined in the given DNA sequence is mutated (changed) to a C? How is the protein affected? This can be answered in a few words, but be specific! (E) Now let's pretend for a moment that the protein being affected is ATP-ADP translocase. What, if anything, would happen to the citric acid cycle? This should be answered in a few words/one sentence max.arrow_forward
- BiochemistryBiochemistryISBN:9781305577206Author:Reginald H. Garrett, Charles M. GrishamPublisher:Cengage LearningBiology 2eBiologyISBN:9781947172517Author:Matthew Douglas, Jung Choi, Mary Ann ClarkPublisher:OpenStax
![Text book image](https://www.bartleby.com/isbn_cover_images/9781305577206/9781305577206_smallCoverImage.gif)
![Text book image](https://www.bartleby.com/isbn_cover_images/9781947172517/9781947172517_coverImage_Textbooks.gif)