STARTING OUT WITH C++ REVEL >IA<
9th Edition
ISBN: 9780135853115
Author: GADDIS
Publisher: PEARSON
expand_more
expand_more
format_list_bulleted
Textbook Question
Chapter 3, Problem 19RQE
The _________ library function returns the remainder of a floating-point division.
Expert Solution & Answer
Learn your wayIncludes step-by-step video
schedule04:30
Students have asked these similar questions
c++
Write a function that returns a float value. The function will check the users entry. It will return a float value which is between 0 and 100 and is divisible by 17
If entered value is not a float, display “Error!!! Not a number”.
If the number is out of range display “Error!!! Outside the range”.
If the number is not between the range, the users will be prompted to enter another number.
It will return only a valid number
I need answer in C programming Language
Create a program that checks if a password and the repeated confirmation password match according to the following criteria:
The password must be at least 8 characters long.
The password and confirmed password must match.
The password must include at least 1 lowercase character.
The password must include at least 1 uppercase character.
The password must include at least 1 number.
The password must include 1 of the following special characters: ! @ # $ ?
In your code, create a function which accepts two character arrays representing the password and repeated password. If the password entered does not meet the requirements listed above, the function should return 1. If the password meets all the requirements, return 0. In main, print a statement indicating the result after the password checking function is called.
Other Requirements
Your code must use consistent formatting and spacing. Points will be taken off for inconsistent or sloppy code.…
// LargeSmall.cpp - This program calculates the largest and smallest of three integer values.
#include <iostream>
using namespace std;
int main()
{
// This is the work done in the housekeeping() function
// Declare and initialize variables here
int largest; // Largest of the three values
int smallest; // Smallest of the three values
// Prompt the user to enter 3 integer values
// Write assignment, add conditional statements here as appropriate
// This is the work done in the endOfJob() function
// Output largest and smallest number.
cout << "The largest value is " << largest << endl;
cout << "The smallest value is " << smallest << endl;
return 0;
}
Chapter 3 Solutions
STARTING OUT WITH C++ REVEL >IA<
Ch. 3.1 - Prob. 3.1CPCh. 3.1 - Prob. 3.2CPCh. 3.1 - Assume value is an integer variable. If the user...Ch. 3.1 - A program has the following variable definitions....Ch. 3.1 - Prob. 3.5CPCh. 3.1 - Complete the following program skeleton so it asks...Ch. 3.2 - Complete the table below by determining the value...Ch. 3.2 - Write C++ expressions for the following algebraic...Ch. 3.2 - Prob. 3.9CPCh. 3.2 - Complete the following program skeleton so it...
Ch. 3.5 - Assume the following variable definitions: int a =...Ch. 3.5 - Complete the following program skeleton so it asks...Ch. 3.5 - Prob. 3.13CPCh. 3.6 - Write a multiple assignment statement that assigns...Ch. 3.6 - Write statements using combined assignment...Ch. 3.6 - Prob. 3.16CPCh. 3.7 - Write cout statements with stream manipulators...Ch. 3.7 - Prob. 3.18CPCh. 3.7 - The following program skeleton asks for an angle...Ch. 3.9 - Prob. 3.20CPCh. 3.9 - Assume the variables angle1 and angle2 hold angles...Ch. 3.9 - To find the cube root (the third root) of a...Ch. 3.9 - The cosecant of the angle a is 1sina Write a...Ch. 3 - Assume the following variables are defined: int...Ch. 3 - Prob. 2RQECh. 3 - Prob. 3RQECh. 3 - Complete the following table by determining the...Ch. 3 - Write C++ expressions for the following algebraic...Ch. 3 - Assume a program has the following variable...Ch. 3 - Assume a program has the following variable...Ch. 3 - Assume qty and salesReps are both integers. Use a...Ch. 3 - Rewrite the following variable definition so that...Ch. 3 - Complete the following table by providing...Ch. 3 - Write a multiple assignment statement that can be...Ch. 3 - Write a cout statement so the variable divSales is...Ch. 3 - Write a cout statement so the variable totalAge is...Ch. 3 - Prob. 14RQECh. 3 - The__________ library function returns the cosine...Ch. 3 - The ___________ library function returns the sine...Ch. 3 - The ________ library function returns the tangent...Ch. 3 - The __________ library function returns the...Ch. 3 - The _________ library functionreturns the...Ch. 3 - The _________ library function returns the natural...Ch. 3 - Prob. 21RQECh. 3 - The _______ library function returns the value of...Ch. 3 - The _________ libraryfunction returns the square...Ch. 3 - The ________ file must beincluded in aprogramthat...Ch. 3 - A retail store grants its customers a maximum...Ch. 3 - Write a pseudocode algorithm for a program that...Ch. 3 - Write a pseudocode algorithm for a program that...Ch. 3 - using namespace std; int main () { double number1,...Ch. 3 - #include iostream using namespace std; int main()...Ch. 3 - #include iostream; using namespace std; int main()...Ch. 3 - #include iostream; using namespace std; main { int...Ch. 3 - #inc1ude iostream; using namespace std; main {...Ch. 3 - #inc1ude iostream; using namespace std; int main()...Ch. 3 - What will each of the following programs display?...Ch. 3 - #include iostream using namespace std; int main()...Ch. 3 - (Assume the user enters George Washington.)...Ch. 3 - (Assume the user enters 36720152. Use a...Ch. 3 - Miles per Gallon Write a program that calculates a...Ch. 3 - Stadium Seating There are three seating categories...Ch. 3 - Test Average Write a program that asks for five...Ch. 3 - Average Rainfall Write a program that calculates...Ch. 3 - Male and Female Percentages Write a program that...Ch. 3 - Ingredient Adjuster A cookie recipe calls for the...Ch. 3 - Box Office A movie theater only keeps a percentage...Ch. 3 - How Many Widgets? The Yukon Widget Company...Ch. 3 - How Many Calories? A bag of cookies holds 30...Ch. 3 - How Much Insurance? Many financial experts advise...Ch. 3 - Automobile Costs Write a program that asks the...Ch. 3 - Celsius to Fahrenheit Write a program that...Ch. 3 - Currency Write a program that will convert U.S....Ch. 3 - Monthly Sales Tax A retail company must file a...Ch. 3 - Property Tax A county collects property taxes on...Ch. 3 - Senior Citizen Property Tax Madison County...Ch. 3 - Math Tutor Write a program that can be used as a...Ch. 3 - Interest Earned Assuming there are no deposits...Ch. 3 - Monthly Payments The monthly payment on a loan may...Ch. 3 - Pizza Pi Joes Pizza Palace needs a program to...Ch. 3 - How Many Pizzas? Modify the program you wrote in...Ch. 3 - Angle Calculator Write a program that asks the...Ch. 3 - Stock Transaction Program Last month Joe purchased...Ch. 3 - Planting Grapevines A vineyard owner is planting...Ch. 3 - Word Game Write a program that plays a word game...
Additional Engineering Textbook Solutions
Find more solutions based on key concepts
Code an SQL statement that creates a table with all columns from the parent and child tables in your answer to ...
Database Concepts (8th Edition)
What is the difference between static and dynamic stacks? What advantages do dynamic stacks have over static st...
Starting Out with C++: Early Objects (9th Edition)
How many hello output lines does this program print?
Computer Systems: A Programmer's Perspective (3rd Edition)
A(n) _____ is a specialized routine that performs a specific operation and then returns a value.
Starting Out With Visual Basic (8th Edition)
Person and Customer Classes The Person and Customer Classes Write a class named Person with data attributes for...
Starting Out with Python (3rd Edition)
Employee and ProductionWorker Classes Write an Employee class that keeps data attributes for the following piec...
Starting Out with Python (4th Edition)
Knowledge Booster
Learn more about
Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, computer-science and related others by exploring similar questions and additional content below.Similar questions
- Q1)Write the function definition for areaOfCircle() which prompts and reads radius then calculateand return the area of circle. Declare π (3.14159) as a memory constant. Note: Formula to calculatearea is πr2(r is radius).arrow_forwardC++ Code: This function will print out the information that has been previously read (using the function readData) in a format that aligns an individual's STR counts along a column. For example, the output for the above input will be: name Alice Bob Charlie ---------------------------------------- AGAT 5 3 6 AATG 2 7 1 TATC 8 4 5 This output uses text manipulators to left-align each name and counts within 10 characters. The row of dashes is set to 40 characters. /** * Computes the longest consecutive occurrences of several STRs in a DNA sequence * * @param sequence a DNA sequence of an individual * @param nameSTRs the STRs (eg. AGAT, AATG, TATC) * @returns the count of the longest consecutive occurrences of each STR in nameSTRs **/ vector<int> getSTRcounts(string& sequence, vector<string>& nameSTRs) For example, if the sequence is AACCCTGCGCGCGCGCGATCTATCTATCTATCTATCCAGCATTAGCTAGCATCAAGATAGATAGATGAATTTCGAAATGAATGAATGAATGAATGAATGAATG and the vector namesSTRs is…arrow_forward(C PROGRAMMING ONLY) 3. How Much Is The House?by CodeChum Admin There's this house I want to buy just right around the corner. I know its address but I don't know its value. Can you please help me determine it? Instructions: In the code editor, you are provided with an initial code which has main() function.In the main(), the user is asked for an integer input and then its address is assigned to a pointer variable (see line 9)Your task is to print the value of the pointer variable using the dereferencing operator.Input 1. An integer Output Enter n: 5Value of *ptr = 5arrow_forward
- C++ part 2 please this is what i have #include <iostream>#include <string>using namespace std; /* Define your functions here. */ int main() { string text;cout<<"Enter a sample text:\n" << endl;getline(cin,text);cout<<"You entered: ";cout<< text << endl; return 0;}arrow_forwardFlowchart, create. #include <iostream>using namespace std;// Write function declaration here void multiplyNumbers(int, int, int &);int main(){ int num1 = 10; int num2 = 20; int product = 0; // Print value of product before function call cout << "Value of product is: " << product << endl; // Call multiplyNumbers using pass by reference for product multiplyNumbers(num1, num2, product); // Print value of calculated product cout << num1 << " * " << num2 << " is " << product << endl; return 0;} // End of main function// Write multiplyNumbers function here; use pass by reference for result of multiplication. Then use pass by address. void multiplyNumbers(int n1, int n2, int &result) { result = n1*n2;}arrow_forwardmy_round(number, integer): Based on the built-in round(...) function. Takes an integer or float and returns a rounded float value that is the number rounded to the second argument's decimal place. First argument can be any float or integer. Second argument must be an integer. Examples: my_round(1234.5678, 2) and round(1234.5678, 2) should return 1234.57. my_round(1234.5678, -2) and round(1234.5678, -2) should return 1200.0.arrow_forward
- Asap 9. Nee Using Dev C ++, create a program: Number Conversion:Convert a Binary Number to Decimal, Octal, and Hexadecimal. The process of how to solve Binary to Octal (ONLY) must be seen at the end of the output or during run time. Requirements: The program created should include the following structures: conditional looping programmer-defined functions (no header file creation) arrays and/or strings p.s. use beginner code only..arrow_forward(PYTHON) (Display characters) Write a function that prints characters using the following header: def printChars(ch1, ch2, numberPerLine): This function prints the characters between ch1 and ch2 with the specified numbers per line. Write a test program that prints ten characters per line from 1 to Z.arrow_forwardC++ Need Help with 3 part #include <iostream>#include <string>using namespace std; void PrintMenue() {cout << "\nMENU" << endl;cout << "c - Number of non-whitespace characters" << endl;cout << "w - Number of words" << endl;cout << "f - Find text" << endl;cout << "r - Replace all !'s" << endl;cout << "s - Shorten spaces" << endl;cout << "q - Quit" << endl;cout << "\nChoose an option:" << endl;} /* Define your functions here. */ int main() { string text;cout << "Enter a sample text:\n" << endl;getline(cin, text);cout << "You entered: ";cout << text << endl;PrintMenue();return 0;}arrow_forward
- #include <iostream>using namespace std; /* Define your function here */ int main() {/* Type your code here. Your code must call the function. */ return 0;}arrow_forward(C PROGRAMMING ONLY) 1. Pointing Fingersby CodeChum Admin I am so mad at my brothers, they always point their fingers to me whenever mom gets angry ? Now that I'm knowledgeable about pointers, I'm going to point all of my 5 fingers to them. Let's see who's tough now! Instructions: In the code editor, you are provided with a main() function where the user is asked for 5 double numbers.Then, in lines 19 - 23, your task is to set the addresses of these numbers to each of the pointers. The address of the first number, a, should be assigned to the first pointer, the address of the second number, b, should be assigned to the second pointer, and so on.Input 1. First number 2. Second number 3. Third number 4. Fourth number 5. Fifth number Output Enter 1st number: 23.2Enter 2nd number: 10.01Enter 3rd number: 800Enter4th number: 24Enter 5th number: 2123.2 10.0 800.0 24.0 21.0arrow_forwardPROGRAM C Operation: Operation by CodeChum Admin You have been cordially invited to partake in Operation: Operation. Your mission, should you choose to accept it, is to take the two numbers and the operator given then perform the operation successfully. Instructions: Input one number (integer or decimal), an operator (+, -, *, /), and another number (integer or decimal). Again, since we're scanning a character, don't forget to add a space before the character's placeholder like this, " %c", so that it won't be the newline character that will be scanned for the operator. Print the result of the operation between the two numbers, up to 2 decimal places. Input 1. First number 2. Operator 3. Second number Output The first line will contain a message prompt to input the first number. The second line will contain a message prompt to input the operator. The third line will contain a message prompt to input the second number. The last line contains the result with 2…arrow_forward
arrow_back_ios
SEE MORE QUESTIONS
arrow_forward_ios
Recommended textbooks for you
- C++ for Engineers and ScientistsComputer ScienceISBN:9781133187844Author:Bronson, Gary J.Publisher:Course Technology PtrMicrosoft Visual C#Computer ScienceISBN:9781337102100Author:Joyce, Farrell.Publisher:Cengage Learning,
C++ for Engineers and Scientists
Computer Science
ISBN:9781133187844
Author:Bronson, Gary J.
Publisher:Course Technology Ptr
Microsoft Visual C#
Computer Science
ISBN:9781337102100
Author:Joyce, Farrell.
Publisher:Cengage Learning,
Introduction to Variables; Author: Neso Academy;https://www.youtube.com/watch?v=fO4FwJOShdc;License: Standard YouTube License, CC-BY