Biochemistry
6th Edition
ISBN: 9781305577206
Author: Reginald H. Garrett, Charles M. Grisham
Publisher: Cengage Learning
expand_more
expand_more
format_list_bulleted
Concept explainers
Question
Chapter 31, Problem 16P
Interpretation Introduction
Interpretation :
At least eight other post-translational modifications and the amino acid residues involved in post translational protein modifications needs to be determined.
Concept Introduction :
The covalent and the enzymatic proteins modification subsequent to protein biosynthesis are known as PTM i.e. Post-translational modification. The ribosomes translate mRNA into polypeptide chains to synthesize proteins that can undergo post-translational modification to produce the protein product that is comparatively mature.
Expert Solution & Answer
Trending nowThis is a popular solution!
Students have asked these similar questions
Situational task: As a result of intoxication, enzymes that provide splicing are not synthesized in liver cells. What is the reason for stopping protein biosynthesis in this case? Justify the answer
Keeping in mind the circular genome of Mitochondria identify the non-coding regulatory region in Mitochondria. What is its translational status? What regulatory function it performs?
How a glycoprotein is translated, modified and ultimately transported to the outer plasma membrane. Be sure to explain the migration of the protein from the beginning of translation to placement in the cellular membrane.
Describe an experiment that might be conducted to determine if any specific signal is necessary for the proper targeting of the ER or the plasma membrane.
Knowledge Booster
Learn more about
Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biochemistry and related others by exploring similar questions and additional content below.Similar questions
- (a) Write a possible sequence for an mRNA segment coding for apamine.(b) Do you think apamine is synthesized in the form, or is it more likely a product of proteolytic cleavage of a larger peptide? Explain.arrow_forwardAlternative Splicing Possibilities Suppose exon 17 were deleted from the fast skeletal muscle troponin T gene (Figure 29.46). How many different mRNAs could now be generated by alternative splicing? Suppose that exon 7 in a wild-type troponin T gene were duplicated. How many different mRNAs might be generated from a transcript of this new gene by alternative splicing?arrow_forwardTRUE OR FALSE: tRNA-met complexes with mRNA at the aminoacyl-site of the ribosomearrow_forward
- 15. Cellular proteins are oftentimes post-translationally modified. Choose one of the following PTMs: N-linked glycosylation, phosphorylation, ubiquitination, or GPI-anchor. Clearly indicate your choice, then address the following: (a) How is the PTM attached to the protein of interest? At which amino acid residue(s)? What enzyme(s) is involved, if any? (b) Is the PTM relatively stable or highly dynamic? Explain. How does the PTM become detached from the protein of interest? What enzyme(s) is involved, if any? (c) What is the function of the PTM? Provide one specific example.arrow_forwardReferring to the genetic code presented in Figure , give the aminoacids specified by the following bacterial mRNA sequences. Q. 5′ –AGGGAAAUCAGAUGUAUAUAUAUAUAUGA–3′arrow_forwardmain binding pocket inside the GLP-1 receptor and the critical residues found in GLP-1 particularly in its N-terminus. what are the amino acids found particularly in its N terminusarrow_forward
- Explain why energy is NOT needed for co-translational translocation but IS needed for post-translational ER translocation of an ER lumenal protein.arrow_forwardRibosomes markedly accelerate thehydrolysis of GTP bound to the complex of EF-Tu and aminoacyltRNA. What is the biological significance ofthis enhancement of GTPase activity by ribosomes?arrow_forwardBinding of --------- identifies the decoding center of the ribosome.arrow_forward
- Referring to the genetic code presented in Figure , give the aminoacids specified by the following bacterial mRNA sequences. Q. 5′ –UUUGGAUUGAGUGAAACGAUGGAUGAAAG AUUUCUCGCUUGA–3′arrow_forwardPosttranslational modifications serve several purposes. Discuss and give examplesarrow_forwardQuestion:- Describe the function of each of the following Shortly. a. Amino-acyl tRNA synthetase b. E coll release factors 1 and 2 (RF1 and RF2) c. 5' methyl-guanosine cap d. Ribosomal P sitearrow_forward
arrow_back_ios
SEE MORE QUESTIONS
arrow_forward_ios
Recommended textbooks for you
- BiochemistryBiochemistryISBN:9781305577206Author:Reginald H. Garrett, Charles M. GrishamPublisher:Cengage Learning
Biochemistry
Biochemistry
ISBN:9781305577206
Author:Reginald H. Garrett, Charles M. Grisham
Publisher:Cengage Learning
QCE Biology: Introduction to Gene Expression; Author: Atomi;https://www.youtube.com/watch?v=a7hydUtCIJk;License: Standard YouTube License, CC-BY