EBK CAMPBELL BIOLOGY IN FOCUS
2nd Edition
ISBN: 8220101459299
Author: Reece
Publisher: PEARSON
expand_more
expand_more
format_list_bulleted
Concept explainers
Videos
Question
Chapter 33, Problem 10TYU
Summary Introduction
To explain:
The reason as to why the damaged keratin protein cannot be replaced by the shampoo containing the same protein.
Introduction:
Keratin is a protein that forms the nails and hairs and outer layer of skin in abundance in humans. It is a fibrous structural protein. In other animals it forms the hoofs claws and horns like in ruminants. It is an extremely tough protein and is insoluble in organic solvents and water. It protects the underlying epithelial cells from the damage or stress. Next protein that is as tough as keratin is chitin.
Expert Solution & Answer
Want to see the full answer?
Check out a sample textbook solution
Students have asked these similar questions
Among the given statements, which one(s) is/are correct about alpha keratin?
I. It is the primary structural protein of the skin.
It. It's structure is reinforced by disulfide bridges from methionine residues.
III. It is made up of 2 right-handed helices that are twisted together to form a sinistral super helix.
Select the correct response:
I only
Ill only
land lI
Il only
I. Il, and III
land Ill
• Il and III
Both a-keratin and collagen are fibrous proteins.however,the hydrogen bonding pattern is different between the helices of the respective proteins.what os the major difference?
Briefly describe the primary structure of collagen, a- keratin and B-keratin.
Chapter 33 Solutions
EBK CAMPBELL BIOLOGY IN FOCUS
Ch. 33.1 - An animal requires 20 amino acids to make...Ch. 33.1 - Prob. 2CCCh. 33.1 - WHAT IF? if a zoo animal eating ample food shows...Ch. 33.2 - Prob. 1CCCh. 33.2 - In what sense are nutrients from a recently...Ch. 33.2 - Prob. 3CCCh. 33.3 - How does swallowed food reach the stomach of a...Ch. 33.3 - Explain why a proton pump inhibitor, such as the...Ch. 33.3 - Prob. 3CCCh. 33.4 - Prob. 1CC
Ch. 33.4 - Prob. 2CCCh. 33.4 - Prob. 3CCCh. 33.5 - Prob. 1CCCh. 33.5 - The energy required to maintain each gram of body...Ch. 33.5 - Prob. 3CCCh. 33 - The mammalian trachea and esophagus both connect...Ch. 33 - Which organ is incorrectly paired with its...Ch. 33 - Which of the following is not a major activity of...Ch. 33 - Prob. 4TYUCh. 33 - Prob. 5TYUCh. 33 - If you were to jog 1 km a few hours after lunch,...Ch. 33 - Prob. 7TYUCh. 33 - Prob. 8TYUCh. 33 - FOCUS ON EVOLUTION The human esophagus and trachea...Ch. 33 - Prob. 10TYUCh. 33 - Prob. 11TYU
Knowledge Booster
Learn more about
Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.Similar questions
- What could be the reason why hydroxylation of proline residues is critical to the structural integrity of collagen? Select the correct response The hydroxyl moities in Pro form disulfide bonds which stabilize collagen structure. The hydroxyl moities in Pro form ionic bonds (salt bridges) which stabilize collagen structure. The hydroxyl moities in Pro form hydrophobic interactions which stabilize collagen structure. The hydroxyl moities in Pro form peptide bonds which stabilize collagen structure. The hydroxyl moities in Pro form H-bonds which stabilize collagen structure.arrow_forwardPlease help me with this question. More than one answer may be correct. Kinesin _______. Options: A) uses ATP B) “walks” the same direction as dynein C) can bind to a kinesin receptor on a vesicle D) “walks” along a microtubule from the – side to + side E) “walks” along a microtubule from the + side to - sidearrow_forwardPlease help me with this question. More than one answer may be correct. Molecules involved in forming an adherens junction include ____. Options: A) occludin B) claudin C) actin D) classical cadherins E) cateninsarrow_forward
- Disease: Huntington’s Disease (200 words) How does the altered protein structure/function lead to changes at the cellular and/or organismal level? How do these changes underlie the disease symptoms? Explain how the mutated protein disrupts cellular, physiological, and/or organismal function. In other words, how do cells function differently because of this mutation? If relevant, how do organs function differently?arrow_forwardProtein 2: DNA AGAGTTCTGCCCTGTCGATTT MRNA Amino Acid Sequence 1. Which kind of protein molecule did this gene make? 2. How does this protein help the body maintain homeostasis?arrow_forwardt, a The n of 4-19. In a common protein analysis, a dye binds to the protein and the color of the dye changes from brown to blue. The intensity of blue color is proportional to the amount of protein present. Protein (ug): 0.00 9.36 18.72 28.08 37.44 Absorbance: 0.466 0.676 0.883 1.086 1.280 2 (a) After subtracting the blank absorbance (0.466) from the remaining absorbances, use the method of least squares to determine the equation of the best straight line through these five points (n and intercept to express the equation in the form y (±s,) = [m (±sm)]x + [b (±sp)] with a reasonable number of signifi- cant figures. 02 5). Use the standard deviation of the slope and and (b) Make a graph showing the experimental data and the cal- culated straight line. and (c) An unknown gave an observed absorbance of 0.973. Cal- culate the number of micrograms of protein in the unknown, and estimate its uncertainty. nreearrow_forward
- Please help me with this question. More than one answer may be correct. Elastin _______. Options: A) has a repeating structure of 3 amino acids such as Gly-Pro-X B) crosslinks with numerous other elastin peptides to make an elastic fiber C) is physically attached to the smooth endoplasmic reticulum D) is physically attached to ribosomes E) is rich in hydrophobic residuesarrow_forwardCompare and contrast structural features of collagen and α-keratin (OK to do this as a list or table comparing/contrasting 3-4 points, e.g. type of helices, noncovalent and covalent interactions between helices, favored residues). Can you please help?arrow_forwardWhich peptide would absorb the most UV light at 280nm? (Can you show work because I mainly want to know how to solve this type of problem. Thank you!)Leu-Trp-Tyr-Ala Tyr-Lys-Tyr-Cys Glu-Tyr-Ile-Arg Ala-Trp-Trp-Ala Thr-Ala-Ile-Thrarrow_forward
- Please help and explain the following question...thank you! Describe instances when a DNA mutation would not alter the function of a protein. Describe instances when a DNA mutation would alter the function of a proteinarrow_forwardIdentification. Write in CAPITAL LETTERS. Wrong spelling, wrong. Proteins are classified according to function,examples of these classes are: _____________________, ________________________, ____________________________, ______________________________, ____________________________, ___________________________, _____________________________.arrow_forwardDifferent organelles are abundant in different cell types. Match the cell types with their abundant organelles by placing the correct letter from column B into each blank in column A. Follow the hints provided in parentheses.Column A Column B(1) cell in the adrenal gland that makes steroid hormones (a) mitochondria(2) white blood cell (phagocytic) (b) smooth ER(3) liver cell (detoxifies poisons) (c) peroxisomes(4) muscle cell (highly contractile) (d) microfilaments(5) mucous cell (secretes protein product) (e) rough ER(6) epithelial cell in the outer layer of skin (withstands tension)…arrow_forward
arrow_back_ios
SEE MORE QUESTIONS
arrow_forward_ios
Recommended textbooks for you
Human Physiology: From Cells to Systems (MindTap ...BiologyISBN:9781285866932Author:Lauralee SherwoodPublisher:Cengage Learning
Human Physiology: From Cells to Systems (MindTap ...
Biology
ISBN:9781285866932
Author:Lauralee Sherwood
Publisher:Cengage Learning
TISSUE REPAIR Part 1: Repair - Regeneration; Author: ilovepathology;https://www.youtube.com/watch?v=t-5EjlS6qjk;License: Standard YouTube License, CC-BY