CAMPBELL BIOLOGY IN FOCUS (LL)-W/MOD.MA
3rd Edition
ISBN: 9780135686065
Author: Urry
Publisher: PEARSON
expand_more
expand_more
format_list_bulleted
Concept explainers
Question
Chapter 33, Problem 9TYU
Summary Introduction
To explain:
The reason as to why the damaged keratin protein cannot be replaced by the shampoo containing the same protein.
Introduction:
Keratin is a protein that forms the nails and hairs and outer layer of skin in abundance in humans. It is a fibrous structural protein. In other animals it forms the hoofs claws and horns like in ruminants. It is an extremely tough protein and is insoluble in organic solvents and water. It protects the underlying epithelial cells from the damage or stress. Next protein that is as tough as keratin is chitin.
Expert Solution & Answer
Want to see the full answer?
Check out a sample textbook solutionStudents have asked these similar questions
Females with curly hair usually use hot iron to straighten it for style. Explain how the hair becomes straighten and the possible effect of excess heat can leave on the proteins in the body.
Both a-keratin and collagen are fibrous proteins.however,the hydrogen bonding pattern is different between the helices of the respective proteins.what os the major difference?
#9 please.
Chapter 33 Solutions
CAMPBELL BIOLOGY IN FOCUS (LL)-W/MOD.MA
Ch. 33.1 - An animal requires 20 amino acids to make...Ch. 33.1 - Prob. 2CCCh. 33.1 - WHAT IF? if a zoo animal eating ample food shows...Ch. 33.2 - Prob. 1CCCh. 33.2 - In what sense are nutrients from a recently...Ch. 33.2 - Prob. 3CCCh. 33.3 - How does swallowed food reach the stomach of a...Ch. 33.3 - Explain why a proton pump inhibitor, such as the...Ch. 33.3 - Prob. 3CCCh. 33.4 - Prob. 1CC
Ch. 33.4 - Prob. 2CCCh. 33.4 - Prob. 3CCCh. 33.5 - Prob. 1CCCh. 33.5 - The energy required to maintain each gram of body...Ch. 33.5 - Prob. 3CCCh. 33 - The mammalian trachea and esophagus both connect...Ch. 33 - Which organ is incorrectly paired with its...Ch. 33 - Which of the following is not a major activity of...Ch. 33 - Prob. 4TYUCh. 33 - Prob. 5TYUCh. 33 - If you were to jog 1 km a few hours after lunch,...Ch. 33 - Prob. 7TYUCh. 33 - FOCUS ON EVOLUTION The human esophagus and trachea...Ch. 33 - Prob. 9TYUCh. 33 - Prob. 10TYU
Knowledge Booster
Learn more about
Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.Similar questions
- I NEED A HELP WITH THIS QUESTION FOR BIOarrow_forwardPlease help me with this question. More than one answer may be correct. Elastin _______. Options: A) has a repeating structure of 3 amino acids such as Gly-Pro-X B) crosslinks with numerous other elastin peptides to make an elastic fiber C) is physically attached to the smooth endoplasmic reticulum D) is physically attached to ribosomes E) is rich in hydrophobic residuesarrow_forwardProteins play many different and important roles in the body. Explain how all of the types of proteins within the body are similar and how they are different. Then, describe if all cells are able to code for proteins.arrow_forward
- Disease: Huntington’s Disease (200 words) How does the altered protein structure/function lead to changes at the cellular and/or organismal level? How do these changes underlie the disease symptoms? Explain how the mutated protein disrupts cellular, physiological, and/or organismal function. In other words, how do cells function differently because of this mutation? If relevant, how do organs function differently?arrow_forward5arrow_forwardCompare and contrast structural features of collagen and α-keratin (OK to do this as a list or table comparing/contrasting 3-4 points, e.g. type of helices, noncovalent and covalent interactions between helices, favored residues). Can you please help?arrow_forward
- Which peptide would absorb the most UV light at 280nm? (Can you show work because I mainly want to know how to solve this type of problem. Thank you!)Leu-Trp-Tyr-Ala Tyr-Lys-Tyr-Cys Glu-Tyr-Ile-Arg Ala-Trp-Trp-Ala Thr-Ala-Ile-Thrarrow_forwardt, a The n of 4-19. In a common protein analysis, a dye binds to the protein and the color of the dye changes from brown to blue. The intensity of blue color is proportional to the amount of protein present. Protein (ug): 0.00 9.36 18.72 28.08 37.44 Absorbance: 0.466 0.676 0.883 1.086 1.280 2 (a) After subtracting the blank absorbance (0.466) from the remaining absorbances, use the method of least squares to determine the equation of the best straight line through these five points (n and intercept to express the equation in the form y (±s,) = [m (±sm)]x + [b (±sp)] with a reasonable number of signifi- cant figures. 02 5). Use the standard deviation of the slope and and (b) Make a graph showing the experimental data and the cal- culated straight line. and (c) An unknown gave an observed absorbance of 0.973. Cal- culate the number of micrograms of protein in the unknown, and estimate its uncertainty. nreearrow_forwardProtein 2: DNA AGAGTTCTGCCCTGTCGATTT MRNA Amino Acid Sequence 1. Which kind of protein molecule did this gene make? 2. How does this protein help the body maintain homeostasis?arrow_forward
- Compared with fibrous and globular proteins.arrow_forwardAll proteins . (Choose the most complete answer.) Group of answer choices have the same number of amino acids are synthesized on ribosomes and are made of amino acids connected by peptide bonds are made of amino acids connected by peptide bonds only are synthesized on ribosomes onlyarrow_forwardDinah had her curly hair rebonded. One chemical is put on her hair to break the disulfide bonds that give the hair stands their shape (curly) and a second chemical is used to reform the disulfide bonds to hold the hair in a straight position. a. What level(s) of protein structure is/are affected by these processes? b. Why doesn’t the hair stay straight forever after this treatmentarrow_forward
arrow_back_ios
SEE MORE QUESTIONS
arrow_forward_ios
Recommended textbooks for you
- Biology 2eBiologyISBN:9781947172517Author:Matthew Douglas, Jung Choi, Mary Ann ClarkPublisher:OpenStaxHuman Physiology: From Cells to Systems (MindTap ...BiologyISBN:9781285866932Author:Lauralee SherwoodPublisher:Cengage Learning
Biology 2e
Biology
ISBN:9781947172517
Author:Matthew Douglas, Jung Choi, Mary Ann Clark
Publisher:OpenStax
Human Physiology: From Cells to Systems (MindTap ...
Biology
ISBN:9781285866932
Author:Lauralee Sherwood
Publisher:Cengage Learning
TISSUE REPAIR Part 1: Repair - Regeneration; Author: ilovepathology;https://www.youtube.com/watch?v=t-5EjlS6qjk;License: Standard YouTube License, CC-BY