BIOLOGY (LL)
5th Edition
ISBN: 9781264115495
Author: BROOKER
Publisher: MCG
expand_more
expand_more
format_list_bulleted
Concept explainers
Textbook Question
Chapter 3.6, Problem 3EQ
CoreSKILL » Explain the result that was crucial to the discovery that the tertiary structure of ribonuclease may depend entirely on the primary structure.
Expert Solution & Answer
![Check Mark](/static/check-mark.png)
Want to see the full answer?
Check out a sample textbook solution![Blurred answer](/static/blurred-answer.jpg)
Students have asked these similar questions
Sequence1
TCGAAATAACGCGTGTTCTCAACGCGGTCGCGCAGATGCCTTTGCTCATCAGATGCGACCGCAACCACGTCCGCCGCCTTGTTCGCCGTCCCCGTGCCTCAACCACCACCACGGTGTCGTCTTCCCCGAACGCGTCCCGGTCAGCCAGCCTCCACGCGCCGCGCGCGCGGAGTGCCCATTCGGGCCGCAGCTGCGACGGTGCCGCTCAGATTCTGTGTGGCAGGCGCGTGTTGGAGTCTAAA
*edited sequence:
1) according to BLAST what is the probable identity of this sequence?
2) what organism does the sequence probably come from genus and species?
3) what is the E value for this sequence ?
4) what is the accession number for this sequen
Give typed full explanation
Given the following sequence of RNA, propose the potential hairpin structure for this RNA. Indicate base pairing with a dotted line. 5’ -AGGACCCUUCGGGGUUCU-3’
The following are sequences from three different alpha helices found inhuman proteins:
hBak(72-87): GQVGRQLAIIGDDINR
hCB1(196-210): VTASFTASVGSLFLT
hCB2(248-262): LVLAVLLICWFPVL
Classify each of these three helices as either a) mostly hydrophobic, b)mostly hydrophilic, or c) amphipathic. Use the helical wheel to explainyour answers.
Given the character of these helices, in which part of the protein wouldyou expect them to reside?
Chapter 3 Solutions
BIOLOGY (LL)
Ch. 3.4 - Prob. 1CCCh. 3.4 - What type of reaction is the reverse of the one...Ch. 3.4 - Prob. 1CSCh. 3.5 - Prob. 1CCCh. 3.5 - Prob. 1CSCh. 3.6 - How many water molecules would be produced during...Ch. 3.6 - Prob. 2CCCh. 3.6 - Prob. 1EQCh. 3.6 - Prob. 2EQCh. 3.6 - CoreSKILL Explain the result that was crucial to...
Ch. 3.7 - Prob. 1CCCh. 3 - Molecules that are found in living cells and...Ch. 3 - The versatility of carbon that allows it to serve...Ch. 3 - Prob. 3TYCh. 3 - Prob. 4TYCh. 3 - Prob. 5TYCh. 3 - In contrast to other fatty acids, essential fatty...Ch. 3 - Prob. 7TYCh. 3 - The monomers of proteins are ___________, and...Ch. 3 - Prob. 9TYCh. 3 - Prob. 10TYCh. 3 - Explain the similarities and differences between...Ch. 3 - Prob. 2CQCh. 3 - Prob. 3CQCh. 3 - Discuss the differences between the various types...Ch. 3 - Prob. 2COQ
Additional Science Textbook Solutions
Find more solutions based on key concepts
Problem Set
True or False? Indicate whether each of the following statements about membrane transport is true (...
Becker's World of the Cell (9th Edition)
A student moving out of a dormitory crouches in correct fashion to lift a heavy box of books. What prime movers...
HUMAN ANATOMY
What are the cervical and lumbar enlargements?
Principles of Anatomy and Physiology
What were the major microbiological interests of Martinus Beijerinck and Sergei Winogradsky? It can be said tha...
Brock Biology of Microorganisms (14th Edition)
How does trandlation differ from transcription?
Microbiology: Principles and Explorations
Why are mutants used as test organisms in the Ames test?
Laboratory Experiments in Microbiology (12th Edition) (What's New in Microbiology)
Knowledge Booster
Learn more about
Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.Similar questions
- What further experiments are needed to provide confidence that the structural data obtained from the SCAM analysis reflects the structure of a properly folded AlaE?arrow_forwardWhich of the following statements regarding Anfinsen's denaturing experiments with ribonuclease A are valid? (i) Exposing the denatured protein to air oxidation and then dialysis to remove urea restored the protein to its original functionality. (ii) Removing urea by dialysis and then allowing air oxidation of the denatured protein restored the protein to its original functionality. (iii) Denaturing the protein with both urea and β-mercaptoethanol yielded an inactive protein. (iv) Protein folding is determined by its primary sequence.arrow_forwardYou have discovered a new protein, one whosesequence has about 25% homology with ribonuclease A. How wouldyou go about predicting, rather than experimentally determining,its tertiary structure?arrow_forward
- The antibiotic cordycepin inhibits bacterial RNA synthesis. Solve, (a) Of which nucleoside is cordycepin a derivative? (b) Explain cordycepin’s mechanism of action.arrow_forward(A) Give the polypeptide translation of the RNA sequence below. 5’-AUGGAAAUCAAAGUCAACCUUGAGUUUAGA-3’ (B) Write the chemical structure of the polypeptide sequence you determined in part (a) (C) Given the chemical structure of the polypeptide sequence you have written in part (b), answer True or False for each of the 5 statements below. (1) At least one of the amino acids in the sequence can undergo phosphorylation (2) The sequence looks like it could form a β turn (3) The sequence looks like it could form a β strand with one surface facing the interior of the protein and the other surface exposed to water (4) At least one of the amino acids in the polypeptide sequence can undergo oxidation to form a disulfide bridge to another polypeptide (5) The sequence looks like it could form an α helix that would be part of a coiled coil structure within a proteinarrow_forwardWhat experimentally derived information led to Holley’s proposal of the two-dimensional cloverleaf model of tRNA?arrow_forward
- Using Fig. as a guide, draw the complete structure of a nucleoside triphosphate before and after it becomes incorporated into a polynucleotide chain. Draw the structure that would result if the newly formed phosphodiester bond were hydrolyzed.arrow_forwardA short RNA molecule was isolated that demonstrated a hyperchromic shift indicating secondary structure . Its sequence was determined to be 5'@AGGCGCCGACUCUACU@3' Propose a two-dimensional model for this molecule.arrow_forwardThe SCAM data for positions V51C and Y96C are different to the other datasets. Describe how the data for these positions are different to the other positions. In each case, explain what the structural basis of these differences may be.arrow_forward
- How do you seal sequence 2 (from 5' end) to the 3' end of the sequence 1 in vitro condition? Design a splint oligomer and write the all-possible content(s) needed for reaction to occur. Sequence 1: 5'ACTGTCGATGCTAGCTTGATCCAAGTATTGCTAGACAGAATTGACATATAGGCGATGCTAGT3' Sequence 2: 5'ATCGCTAGGATCGCTAGATTTAAGTCGCTGATCGGCTAGATATAACAGGTCCTGAATCGCTA3'arrow_forward. Give two reasons to explain why a proline residue in the middle of an ahelix is predicted to be destabilizing to the helical structurearrow_forwardTRUE OR FALSE a) The structure of the purines and pyrimidines make them able to undergo keto-enol tautomerism. b) A unique 5'CCA terminal sequence is found in all tRNAs to be able to carry the correct amino acid to the ribosome.arrow_forward
arrow_back_ios
SEE MORE QUESTIONS
arrow_forward_ios
Recommended textbooks for you
- Human Anatomy & Physiology (11th Edition)BiologyISBN:9780134580999Author:Elaine N. Marieb, Katja N. HoehnPublisher:PEARSONBiology 2eBiologyISBN:9781947172517Author:Matthew Douglas, Jung Choi, Mary Ann ClarkPublisher:OpenStaxAnatomy & PhysiologyBiologyISBN:9781259398629Author:McKinley, Michael P., O'loughlin, Valerie Dean, Bidle, Theresa StouterPublisher:Mcgraw Hill Education,
- Molecular Biology of the Cell (Sixth Edition)BiologyISBN:9780815344322Author:Bruce Alberts, Alexander D. Johnson, Julian Lewis, David Morgan, Martin Raff, Keith Roberts, Peter WalterPublisher:W. W. Norton & CompanyLaboratory Manual For Human Anatomy & PhysiologyBiologyISBN:9781260159363Author:Martin, Terry R., Prentice-craver, CynthiaPublisher:McGraw-Hill Publishing Co.Inquiry Into Life (16th Edition)BiologyISBN:9781260231700Author:Sylvia S. Mader, Michael WindelspechtPublisher:McGraw Hill Education
![Text book image](https://www.bartleby.com/isbn_cover_images/9780134580999/9780134580999_smallCoverImage.gif)
Human Anatomy & Physiology (11th Edition)
Biology
ISBN:9780134580999
Author:Elaine N. Marieb, Katja N. Hoehn
Publisher:PEARSON
![Text book image](https://www.bartleby.com/isbn_cover_images/9781947172517/9781947172517_coverImage_Textbooks.gif)
Biology 2e
Biology
ISBN:9781947172517
Author:Matthew Douglas, Jung Choi, Mary Ann Clark
Publisher:OpenStax
![Text book image](https://www.bartleby.com/isbn_cover_images/9781259398629/9781259398629_smallCoverImage.gif)
Anatomy & Physiology
Biology
ISBN:9781259398629
Author:McKinley, Michael P., O'loughlin, Valerie Dean, Bidle, Theresa Stouter
Publisher:Mcgraw Hill Education,
![Text book image](https://www.bartleby.com/isbn_cover_images/9780815344322/9780815344322_smallCoverImage.gif)
Molecular Biology of the Cell (Sixth Edition)
Biology
ISBN:9780815344322
Author:Bruce Alberts, Alexander D. Johnson, Julian Lewis, David Morgan, Martin Raff, Keith Roberts, Peter Walter
Publisher:W. W. Norton & Company
![Text book image](https://www.bartleby.com/isbn_cover_images/9781260159363/9781260159363_smallCoverImage.gif)
Laboratory Manual For Human Anatomy & Physiology
Biology
ISBN:9781260159363
Author:Martin, Terry R., Prentice-craver, Cynthia
Publisher:McGraw-Hill Publishing Co.
![Text book image](https://www.bartleby.com/isbn_cover_images/9781260231700/9781260231700_smallCoverImage.gif)
Inquiry Into Life (16th Edition)
Biology
ISBN:9781260231700
Author:Sylvia S. Mader, Michael Windelspecht
Publisher:McGraw Hill Education
Mitochondrial mutations; Author: Useful Genetics;https://www.youtube.com/watch?v=GvgXe-3RJeU;License: CC-BY