A short RNA molecule was isolated that demonstrated a hyperchromic shift indicating secondary structure . Its sequence was determined to be 5'@AGGCGCCGACUCUACU@3' Propose a two-dimensional model for this molecule.
Q: DNA in human mitochondria encodes 22 different tRNA molecules. However, 32 different tRNA molecules…
A: Mitochondrial gene expression maintain cellular homoeostasis. Mitochondrial gene expression is…
Q: The hypothetical mRNA sequence below contains the coding region for a short peptide. What…
A: Mutation generally occurs when the base pair of the DNA gets altered by Mutagens or other chemicals…
Q: A short RNA molecule was isolated that demonstrated a hyperchromic shift indicating secondary…
A: Ribonucleic acid (RNA) is a single-stranded polymer of ribonucleotides. Each ribonucleotide unit is…
Q: CAUCGGAAUAGAUCGCUAGUGGCAGGCAUAAUGAUCACCGGUCUGAGAAAAGUGGUACAUAUCAAC-5
A: Genetic codes are read in the form of triplets.first we will convert them to the triplets and then…
Q: Different sigma factors in E. coli cells share Select one: O a. same core RNA polymerase O b. same…
A: 7.) Answer is option c
Q: What is the molecular weight of an mRNA that codes for the protein of molecular weight 75000KD?…
A: The translation is a process in which protein gets synthesized from mRNA template. It occurs in 3…
Q: Structural analysis of bacterial release factor 1 (RF-1) and release factor 2 (RF-2) reveals that…
A: Release factors come into the role in the termination of the translation process. Protein synthesis…
Q: Several experiments were conducted to obtain information about how the eukaryotic ribosome…
A: Gene expression is a process by which the genes are turned on to form RNA and proteins. This is seen…
Q: Phenylalanine (Phe) is encoded by either UUU or UUC, while Tyrosine (Tyr) is encoded only by UAC and…
A: Given Phenylalanine (Phe) is encoded by either UUU or UUC, while Tyrosine (Tyr) is encoded only by…
Q: A shortened version (apo B-48) of apolipoprotein B is formed by the intestine, whereas the…
A: Chylomicrons are a type of lipoprotein particles made up of phospholipids, cholesterol, proteins,…
Q: Consider the following coding 71 nucleotide DNA template sequence (It does not contain a…
A: In cell protein formed according to the sequence on mRNA. mRNA is formed from DNA sequence by the…
Q: The DNA sequence of a short gene from a sea slug, and the mature RNA synthesized from this gene, are…
A: The transcription is the process in which the mRNA copied information from DNA for protein…
Q: The antibiotic paromomycin binds to a ribosome and induces the same conformational changes in 16S…
A: Ribosomes are complex molecules that are composed of ribosomal RNA molecules where photosynthesis…
Q: There are three termination codons (UAA, UAG, UGA) but usually only one initiation codon (AUG) is…
A: The initiation codon is also referred to as start codon which marks the beginning of the translation…
Q: What type of motif/domain is present in the RPB2 subunit? What could be the function of this motif…
A: motif:Protein or nucleic acids are present in protein structure chain like biological molecules.A…
Q: Shown below is an R loop prepared for electron microscopy by annealing a purified eukaryotic…
A: An exon is any part of a gene that will encode a part of the final mature RNA produced by that gene…
Q: Consider the following wild-type and mutant sequences:Wild-type ....CTTGCAAGCGAATC....Mutant…
A: Deoxyribonucleic acid (DNA) is a biomolecule found in nearly all living organisms. The structure of…
Q: The 5′ region of the TPP riboswitch in Bacillus subtilis is very similar to the TPP riboswitch in E.…
A: Bacterias are genetically regulated by RNA, they use a ribonucleic acid sequence encoded within mRNA…
Q: Draw the complete structure of RNA dinucleotide 5'-CU-3' (cytosine-uracil) with a 7-methyl guanosine…
A: In eukaryotes, mRNA molecules undergo modifications after the synthesis. The RNA produced during…
Q: Given the following sequence for an RNA molecule, find a second- ary structure that will be…
A: RNA or ribonucleic acid is a chain of ribonucleotides. Ribonucleotides are made uo of three units:…
Q: In eukaryotic cells, mRNAs have been found to have a circular arrangement in which proteins hold the…
A: In the context of cell biology, the rate of mRNA translation into cellular proteins called…
Q: The following polynucleotide was synthesized and used as a template for peptide synthesis in a…
A: The DNA template is used to form an mRNA polynucleotide by the process of transcription. The mRNA…
Q: In prokaryotic protein synthesis, formylmethionine (fmet) is the first amino acid incorporated,…
A: Methionine which is a central molecule in one-carbon metabolism is an essential amino acid needed…
Q: From this overall anticodon sequence in tRNA,…
A: Biological macromolecules are those large molecules that are necessary for the survival and growth…
Q: Several experiments were conducted to obtain information about how the eukaryotic ribosome…
A: Ribosomes are the protein synthesizing machinery present in a cell. A protein is synthesized during…
Q: Why is yeast RNA insoluble in cold water, ethanol and HCl? And why yeast RNA soluble in hot water…
A: RNA It is referred to as ribonucleic acid. It is another nucleic acid found in cells apart from…
Q: The genetic code is thought to have evolved to maximize genetic stability by minimizing the effect…
A: Mutation is the alteration in the genome sequence. It can occur in the genetic code of eukaryotes,…
Q: Introns in protein-coding genes of some eukaryotes are rarely shorter than 65 nucleotides long. What…
A: Unconstrained DNA sequence which are those sequences whose evolution is unaffected by selection are…
Q: In a coding experiment using repeating copolymers, the following data were obtained. Copolymer…
A: DNA- RNA -PROTEIN that's the central dogma of life,
Q: The ribosome can transfer any peptidyl group from the P-site tRNA to any aminoacyl group on the…
A: Proteins or polypeptides are sequence of amino acids which are linked by peptide bond or amide bond.…
Q: The 5′ sequence for the mRNA for E. coli ribosomal L10 protein is shownbelow. Identify the…
A: Shine-delgrano sequence in mRNA is essential for the binding of prokaryotic ribosomes to carry out…
Q: Eukaryotes modify mRNA with an m7G cap: an N7-methylated guanosine linked via a 5′ to 5′…
A: Post transcriptional capping refers to the attachment of an enzymatically appended cap on the 5'…
Q: Assuming that each nucleotide is 0.34 nm long in mRNA, howmany triplet codes can simultaneously…
A: Nucleotide : It is an organic molecule that is the building block of DNA and RNA. They also have…
Q: Describe how the base pairing between the Shine–Dalgarno sequence and the 30S subunit provides a…
A: The translation represents the process of protein synthesis by which the base sequence of the mRNA…
Q: A short RNA molecule was isolated that demonstrated a hyperchromicshift , indicating secondary…
A: Answer- The formation of mRNA from the coding strand of the DNA is called translation. It happens in…
Q: A short RNA molecule was isolated that demonstrated a hyperchromic shift indicating secondary…
A: Answer- The DNA is converted by the transcription into mRNA. This process happens in the nucleus of…
Q: Eukaryotes modify mRNA with an m7G cap: an N7-methylated guanosine linked via a 5′ to 5′…
A: Post transcriptional modification in Eukaryotic mRNA occurs by its enzymatic caping. The capping of…
Q: . The following synthetic polynucleotide is synthesized and used as a template for peptide synthesis…
A: Polypeptide is made up of chain of amino acids linked together. Polypeptides are connected together…
Q: If an RNA molecule could form a hairpin with asymmetric internal loop, as shown in Figure Q6–5,…
A: The nucleic acid is a significant macromolecule found in all living organisms. The molecule is…
Q: For the case n = 5, the equilibrium constant for this reaction, Keg, is 5-10³ and for n= 6 Keg =…
A: Thermodynamics in biochemistry is the quantitative study of the change in energy which occurs in or…
Q: Low-resolution X-ray diffraction analysis of a protein composed of long stretches of the sequence…
A: Fibroins are insoluble proteins that are present in silk produced by insects, such as the larvae of…
Q: Based on this alignment, you can identify areas of the protein sequences that are key regions of the…
A: Multiple sequence alignment is used to obtain optimal matching between three or more sequences of…
Q: Position on the small and large ribosomal subunits which the peptidyl-tRNA occupies prior to peptide…
A: The DNA (deoxyribonucleic acid) is the genetic material of an organism. The DNA is transcribed to…
Q: Several experiments were conducted to obtain information about how the eukaryotic ribosome…
A: Central dogma of life involves gene expression, or the flow of genetic information from genes to…
Q: Several experiments were conducted to obtain information about how the eukaryotic ribosome…
A: The start codon is the first codon of an mRNA (messenger RNA ) transcript translated by a ribosome.…
Q: Consider the following portion of mRNA: 3'-CUU-AAA-CGA-GUU-5' What is the primary amino acid…
A: mRNA(messenger RNA) carries the genetic information copied from DNA in the form of a series of…
A short RNA molecule was isolated that demonstrated a hyperchromic shift indicating secondary structure . Its sequence was determined to be
5'@AGGCGCCGACUCUACU@3'
Propose a two-dimensional model for this molecule.
Trending now
This is a popular solution!
Step by step
Solved in 2 steps with 1 images
- A short RNA molecule was isolated that demonstrated a hyperchromic shift indicating secondary structure . Its sequence was determined to be 5'@AGGCGCCGACUCUACU@3' What DNA sequence would give rise to this RNA moleculethrough transcription?A short RNA molecule was isolated that demonstrated a hyperchromic shift indicating secondary structure . Its sequence was determined to be 5'@AGGCGCCGACUCUACU@3' If the molecule were a tRNA fragment containing a CGAanticodon, what would the corresponding codon be?A short RNA molecule was isolated that demonstrated a hyperchromicshift , indicating secondary structure. Itssequence was determined to be5'-AGGCGCCGACUCUACU-3'(a) Propose a two-dimensional model for this molecule.(b) What DNA sequence would give rise to this RNA moleculethrough transcription?(c) If the molecule were a tRNA fragment containing a CGA anticodon,what would the corresponding codon be?(d) If the molecule were an internal part of a message, whatamino acid sequence would result from it following translation?
- Consider the following coding 71 nucleotide DNA template sequence (It does not contain a translational start): 5’- GTTTCCCCTATGCTTCATCACGAGGGCACTGACATGTGTAAACGAAATTCCAACCTGAGCGGCGT GTTGAG-3’ By in vitro translating the mRNA, you determined that the translated peptide is 15 amino acids long. What is the expected peptide sequence in single letter abbreviations?Draw the structure of a phosphonamidite monomer suitable for SPPS of adenosine RNA Nucleosides. Circle all protecting groups and identify their canonical deprotection conditions.Give typed full explanation Given the following sequence of RNA, propose the potential hairpin structure for this RNA. Indicate base pairing with a dotted line. 5’ -AGGACCCUUCGGGGUUCU-3’
- Refer to the DNA sequence provided: 3’ -TACTGAAGCGGCAGCCCCGCATGAGTAGACCTTACT-5’ a. What is the mRNA transcript of the anticoding strand of the DNA model? b. What is the amino acid sequence of the polypeptide chain that will be translated from the mRNA in (a)?Eukaryotes modify mRNA with an m7G cap: an N7-methylated guanosine linked via a 5′ to 5′ triphosphate linkage, and by methylation at the 2'-hydroxyl of the penultimate nucleoside. What cofactors involved in the capping reaction? Show their structure and propertiesBelow is an image of the predicted RNA secondary structure for an RNA aptamer that binds FGF5. The boxed nucleotide bases are conserved across all of the high-affinity FGF5 binding RNA aptamers. Although the precise structural mechanism of FGF5 binding is not known, provide a hypothesis for how these bases might contribute to the binding specificity. Explain your answer Loop I a G Stem I 5' с с U 3' g-c g-c u-a a-u 9-c c-g u-a g-c u-a a-u Loop II U CAUGCCUC 111111 UAUGU IITT ACCUACAGAGCGAC AUAC UA Stem II Stem III
- Eukaryotes modify mRNA with an m7G cap: an N7-methylated guanosine linked via a 5′ to 5′ triphosphate linkage, and by methylation at the 2'-hydroxyl of the penultimate nucleoside. Provide a summary of the chemical steps and cofactors involved in the capping reaction.The following DNA sequences found on the sense strand belong to the same eukaryotic gene: Sequence 1: 5'-GATTCAATAAAGCTCAGATCGCTCACGTCGCGACTC-3' Sequence 2: 5'-TCCGAGGTCACTAGATACTCGTCGATCGTATAAATG-3' a) Which sequence is likely to be found upstream from the coding sequence? Justify your answer. b) Which sequence is likely to be found downstream from the coding sequence? Justify your answer. c) Which sequence will not be transcribed into an mRNA transcript? Justify your answer.Design a primer pair using NCBI Primer-BLAST for gene RNA 2',3'-cyclic phosphate and 5'-OH ligase (RTCB) (Homo sapiens); with accession number NM_014306.5. Fill in the following table with the details of the designed primer pair. Please share the graphical report and detailed report screen shot for the selected primer pair. Please write the primers sequence: