Concept explainers
The genome of the bacterium Neisseria gonorrhoeae consists of one double-stranded DNA molecule that contains 2220 kilobase pairs. If 85% of this DNA molecule is made up of the open reading frames of genes encoding proteins, and the average protein is 300 amino acids long, how many protein-encoding genes does Neisseria have? What kind of genetic information is present in the other 15% of the DNA?
To discuss:
The Neisseria gonorrhoeae bacterial genome consists of one double stranded DNA and that contains 2220 Kbp. If 85% of this DNA sequence is made up of open reading frames of genes encoding proteins, and the average protein size is 300 amino acids long, Neisseria contains how many protein-encoding genes. Other 15% of the DNA sequence contains what kind of genetic information.
Concept introduction:
Open reading frames or ORF is a specific segment of DNA or RNA molecule and that part can be translated into a protein sequence. An open reading frame (ORF) (sequence of nucleotides) contains a start codon (AUG) followed by a stretch of various codons and end with a stop codon (UAA, UGA, or UAG). An ORF region in the mRNA is essential for its translation.
Explanation of Solution
The Neisseria gonorrhoeae bacterial genome contains 2220 Kbp or 2,220,000 bp.
Each base pair size is 0.34 nm.
Therefore 2220 Kbp x 0.34 nm is 754, 800 nm.
The length of DNA is 754, 800 nm or 0.07548 cm
If 85% of the bacterial genome is composed of open reading frames, 1,887 Kbp of DNA sequence could be the open reading frames.
(
Average size of the protein is 300 amino acids. Each amino acid is encoded by three nucleotides (one codon). Therefore, 900 bp of DNA sequence in the open reading frame encode proteins.
Number of protein coding bacterial gene is 2097. The remaining 15 % of the bacterial DNA can be non-coding genes, which may regulate gene expression.
Want to see more full solutions like this?
Chapter 4 Solutions
Brock Biology of Microorganisms, Books a la Carte Edition
- In the human gene for the beta chain of haemoglobin (the oxygen-carrying protein in the red blood cells), the first 30 nucleotides in the amino-acid-coding region is represented by the sequence: 3'-TACCACGTGGACTGAGGACTCCTCTTCAGA-5'. What is the sequence of the partner strand?arrow_forwardin the human gene for the beta chain of hemoglobin, the first 30 nucleotides in the amino acid coding region is represented by the sequence 3'TACCACGTGGACTGAGGACTCCTCTTCAGA-5'. What is the sequence of the partner strand? If the DNA duplex for the beta chain of hemoglobin above were transcribed from left to right, deduce the base sequence of the RNA in this coding region.arrow_forwardThe E. coli genome contains 1009 Chi sequences. Do these sequences occur at random, and, if not, how much more or less frequently than random do they occur?arrow_forward
- The following is the base sequence of DNA that codes for first eight amino acids of the β chain of hemoglobin. The β chain of hemoglobin contains a total of 147 amino acids so this is a small part of the entire gene. DNA Template Strand: TACCACGTGGACTGAGGACTCCTC 1. What is the minimum number of DNA nucleotides in this whole gene? 2. What is the sequence of bases on the strand of DNA that is complementary to the template strand? 3. What mRNA will be formed from the template strand of DNA?arrow_forward. While studying the structure of a small gene that was recently sequenced during the Human Genome Project, an investigator notices that one strand of the DNA molecule contains the following: 20 adenine (A) bases 30 cytosine (C) bases25 guanine (G) bases 22 thymine (T) bases How many of each base is found in the complete double-stranded molecule?arrow_forwardThe DNA of a deletion of alpha bacteriophage has a length of 15 micrometers instead of 17 micrometers? How many base pairs are missing from this mutant?arrow_forward
- In addition to the standard base-paired helical structures, DNA can form X-shaped hairpin structures called cruciforms in which most bases are involved in Watson–Crick pairs. Such structures tend to occur at sequences with inverted repeats. Draw the cruciform structure formed by the DNA sequence TCAAGTCCACGGTGGACTTGC.arrow_forwardApproximately what portion of the human genome is composed of repeat sequences?arrow_forwardThe following is the base sequence of DNA that codes for first eight amino acids of the β chain of hemoglobin. The β chain of hemoglobin contains a total of 147 amino acids so this is a small part of the entire gene. DNA Template Strand: TACCACGTGGACTGAGGACTCCTC 1. What is the minimum number of DNA nucleotides in this whole gene? 3 2. What is the sequence of bases on the strand of DNA that is complementary to the template strand? 3' TACCACGTGGACTGAGGACTCCTC 5' . 5' ATGGTGCACCTGACTCCTGAGGAG 3' 3. What mRNA will be formed from the template strand of DNA? Sequence of mRNA formed from DNA template strand is shown below: 3' TACCACGTGGACTGAGGACTCCTC 5' . 5'AUGGUGCACCUGACUCCUGAGGAG 3 4. What amino acids will this mRNA code for? 5. If the 20th base in the template strand of the DNA is changed from T to A, rewrite the new template strand below. 6. When the template strand of the DNA is changed, this is referred to as a mutation. What kind of mutation is…arrow_forward
- In the human gene for the beta chain of haemoglobin (the oxygen-carrying protein in the red blood cells), the first 30 nucleotides in the amino-acid-coding region is represented by the sequence: 3'-TACCACGTGGACTGAGGACTCCTCTTCAGA-5'. What is the sequence of the partner strand? 4B. If the DNA duplex for the beta chain of haemoglobin above were transcribed from left to right, deduce the base sequence of the RNA in this coding region. 4C. In NOT more than 200 words, explain how eukaryotic RNA synthesized by RNA polymerase II is modified before leaving the nucleus?arrow_forwardWhat will be the order of amino acids derived from the following DNA sequence 5’-TGATCGCACAAT-3’? Explain briefly. (1.5) If the base G (denoted by an asterisk) in the sequence 5’-TGATCG*CACAAT-3’ is replaced by C due to a mutation, the new sequence will be 5’-TGATCCCACAAT-3’ what will be the new amino acid sequence? Explain briefly. (1.5) If the anticodon sequence of a tRNA is 5’-GCG-3’, what amino acid will it carry? Explain briefly. (1.5) What would be the effect of mutation if the C is changed to A in the anticodon? Explain briefly. (1.5)arrow_forwardAlthough DNA transposons are abundant in the genomes of multicellular eukaryotes, class 1 elements usually make up the largest fraction of very large genomes such as those from humans (~2500 Mb), maize (~2500 Mb), and barley (~5000 Mb). Given what you know about class 1 and class 2 elements, what is it about their distinct mechanisms of transposition that would account for this consistent difference in abundance?arrow_forward
- Biology: The Dynamic Science (MindTap Course List)BiologyISBN:9781305389892Author:Peter J. Russell, Paul E. Hertz, Beverly McMillanPublisher:Cengage Learning