The primary eight amino acids for each of the given DNA sequences, which are given as follows: ATGTCTCTCACCAACAAGAACGTC ATGgCTCTCACCAACAAGAACGTC ATGTCgCTCACCAACAAGAACGTC ATGTCTtTgACCAACAAGAACGTC ATGTCTCTCACCAACAAGAACGTg Introduction: The given DNA sequences encode the initial eight amino acids for five alleles of the Adh protein in Drosophila pseudoobscura . Nucleotides that vary from the first sequence are shown by a lowercase letter. The sequences of DNA code for a number of alleles. The alleles are responsible for specific assignation of characters to the individual. There are a number of alleles that can be present within a gene. The genes are present in the chromosomes, and the chromosomes are present in pairs. Alleles are responsible for the genotypic character of the organism, which reflects in the phenotype of the organism.

Question

Want to see more full solutions like this?

Answer 1

Question

Chapter 4, Problem 1PDT

a.

Summary Introduction

To determine: The primary eight amino acids for each of the given DNA sequences, which are given as follows:

ATGTCTCTCACCAACAAGAACGTCATGgCTCTCACCAACAAGAACGTCATGTCgCTCACCAACAAGAACGTCATGTCTtTgACCAACAAGAACGTCATGTCTCTCACCAACAAGAACGTg

Introduction: The given DNA sequences encode the initial eight amino acids for five alleles of the Adh protein in Drosophila pseudoobscura. Nucleotides that vary from the first sequence are shown by a lowercase letter. The sequences of DNA code for a number of alleles. The alleles are responsible for specific assignation of characters to the individual. There are a number of alleles that can be present within a gene. The genes are present in the chromosomes, and the chromosomes are present in pairs. Alleles are responsible for the genotypic character of the organism, which reflects in the phenotype of the organism.

a.

Expert Solution

Explanation of Solution

The given DNA sequences are as follows:

ATGTCTCTCACCAACAAGAACGTCATGgCTCTCACCAACAAGAACGTCATGTCgCTCACCAACAAGAACGTCATGTCTtTgACCAACAAGAACGTCATGTCTCTCACCAACAAGAACGTg

The amino acids from the above DNA sequences using the codon table are given below:

MetSerLeuThrAsnLysAsnVal MetAlaLeuThrAsnLysAsnVal MetSerLeuThrAsnLysAsnValMetSerLeuThrAsnLysAsnValMetSerLeuThrAsnLysAsnVal

b.

Summary Introduction

To determine: The five polymorphic sites and signify whether the site is represented by synonymous or non-synonymous polymorphisms in the given DNA sequences.

ATGTCTCTCACCAACAAGAACGTCATGgCTCTCACCAACAAGAACGTCATGTCgCTCACCAACAAGAACGTCATGTCTtTgACCAACAAGAACGTCATGTCTCTCACCAACAAGAACGTg

Introduction: The given DNA sequences encode the initial eight amino acids for five alleles of the Adh protein in Drosophila pseudoobscura. Nucleotides that vary from the first sequence are shown by a lowercase letter. The sequences of DNA code for a number of alleles. The alleles are responsible for specific assignation of characters to the individual. There are a number of alleles that can be present within a gene. The genes are present in the chromosomes, and the chromosomes are present in pairs. Alleles are responsible for the genotypic character of the organism, which reflects in the phenotype of the organism.

b.

Expert Solution

Explanation of Solution

The process of polymorphism results in the modification of the nucleotide. The “synonymous polymorphism” is defined as the production of the same type of amino acid after the modification in the nucleotide.

The synonymous or non-synonymous polymorphisms in sequences are as follows:

MetSerLeuThrAsnLysAsnVal - SynonymousMetAlaLeuThrAsnLysAsnVal - Non-synonymous MetSerLeuThrAsnLysAsnVal - SynonymousMetSerLeuThrAsnLysAsnVal - SynonymousMetSerLeuThrAsnLysAsnVal - Synonymous

The production of “alanine” in the second sequence fulfills the criteria of polymorphism.

c.

Summary Introduction

To determine: The one-difference intermediate in the production of TTG from CTC.

ATGTCTCTCACCAACAAGAACGTCATGgCTCTCACCAACAAGAACGTCATGTCgCTCACCAACAAGAACGTCATGTCTtTgACCAACAAGAACGTCATGTCTCTCACCAACAAGAACGTg

Introduction: The given DNA sequences encode the initial eight amino acids for five alleles of the Adh protein in Drosophila pseudoobscura. Nucleotides that vary from the first sequence are shown by a lowercase letter. The sequences of DNA code for a number of alleles. The alleles are responsible for specific assignation of characters to the individual. There are a number of alleles that can be present within a gene. The genes are present in the chromosomes, and the chromosomes are present in pairs. Alleles are responsible for the genotypic character of the organism, which reflects in the phenotype of the organism.

c.

Expert Solution

Explanation of Solution

According to the provided information, the CTC sequence is responsible for the production of TTG sequence. Both the codons code for “Leu.” However, the codon that could be the intermediate of the process could be the same as “leu.” TTC codes for the “Phe” when activated; hence, it cannot be the intermediate in the reaction. Hence, the one-difference intermediate must be CTG, which also codes for the “Leu” that forms the bridge in the production of TTG from the CTC codon.

d.

Summary Introduction

To determine: The reason that synonymous polymorphisms are likely to be more frequent than non-synonymous polymorphisms.

ATGTCTCTCACCAACAAGAACGTCATGgCTCTCACCAACAAGAACGTCATGTCgCTCACCAACAAGAACGTCATGTCTtTgACCAACAAGAACGTCATGTCTCTCACCAACAAGAACGTg

Introduction: The given DNA sequences encode the initial eight amino acids for five alleles of the Adh protein in Drosophila pseudoobscura. Nucleotides that vary from the first sequence are shown by a lowercase letter. The sequences of DNA code for a number of alleles. The alleles are responsible for specific assignation of characters to the individual. There are a number of alleles that can be present within a gene. The genes are present in the chromosomes, and the chromosomes are present in pairs. Alleles are responsible for the genotypic character of the organism, which reflects in the phenotype of the organism.

d.

Expert Solution

Explanation of Solution

There is a repetition of “3-letter codes” along the codon for the coding of specific amino acid. The production of new amino acid takes place when there is a change in the second element, resulting in non-synonymous polymorphism. However, changes in the third element of the codon give the similar amino acid. Thus, synonymous polymorphisms are likely to be more frequent than non-synonymous polymorphisms.

MetSerLeuThrAsnLysAsnVal - SynonymousMetAlaLeuThrAsnLysAsnVal - Non-synonymous MetSerLeuThrAsnLysAsnVal - SynonymousMetSerLeuThrAsnLysAsnVal - SynonymousMetSerLeuThrAsnLysAsnVal - Synonymous

Want to see more full solutions like this?

Subscribe now to access step-by-step solutions to millions of textbook problems written by subject matter experts!

Students have asked these similar questions

You have the following sequence reads from a genomic clone of the Drosophila melanogaster genome:Read 1: TGGCCGTGATGGGCAGTTCCGGTGRead 2: TTCCGGTGCCGGAAAGARead 3: CTATCCGGGCGAACTTTTGGCCGRead 4: CGTGATGGGCAGTTCCGGTGRead 5: TTGGCCGTGATGGGCAGTTRead 6: CGAACTTTTGGCCGTGATGGGCAGTTCCUse these six sequence reads to create a sequence contig of this part of the D. melanogaster genome.

he Sequence below comes from the alpha-2 globin of the human hemoglobin gene cluster found in chromosome 16. The globin region of the hemoglobin protein itself consists of 2 alpha chains and 2 beta chains. 1 actcttctgg tccccacaga ctcagagaga acccaccatg gtgctgtctc ctgccgacaa 61 gaccaacgtc aaggccgcct ggggtaaggt cggcgcgcac gctggcgagt atggtgcgga 121 ggccctggag aggatgttcc tgtccttccc caccaccaag acctacttcc cgcacttcga 181 cctgagccac ggctctgccc aggttaaggg ccacggcaag aaggtggccg acgcgctgac 241 caacgccgtg gcgcacgtgg acgacatgcc caacgcgctg tccgccctga gcgacctgca 301 cgcgcacaag cttcgggtgg acccggtcaa cttcaagctc ctaagccact gcctgctggt 361 gaccctggcc gcccacctcc ccgccgagtt cacccctgcg gtgcacgcct ccctggacaa 421 gttcctggct tctgtgagca ccgtgctgac ctccaaatac cgttaagctg gagcctcggt 481 agccgttcct cctgcccgct gggcctccca acgggccctc ctcccctcct tgcaccggcc 541 cttcctggtc…

A 210-bp sequence within the CFTR gene on human chromosome 7 is shown below. The three bold underlined nucleotides are deleted in a common cystic fibrosis (CF) mutation, removing a phenylalanine amino acid from the CFTR protein. 1 AGAGGGTAAA ATTAAGCACA GTGGAAGAAT TTCATTCTGT TCTCAGTTTT 51 CCTGGATTAT GCCTGGCACC ATTAAAGAAA ATATCATCTT TGGTGTTTCC 101 TATGATGAAT ATAGATACAG AAGCGTCATC AAAGCATGCC AACTAGAAGA 151 GGTAAGAAAC TATGTGAAAA CTTTTTGATT ATGCATATGA ACCCTTCACA 201 CTACCCAAAT PCR primers have been designed to amplify fragments within this sequence: Forward: GGATTATGCCTGGCACCATT Reverse: AGTGTGAAGGGTTCATATGC DNA from a CF patient is tested with a PCR assay using a pair of these primers, and the PCR product is found to be 3 bp shorter than that expected from the sequence shown above. What length PCR products (in bp) would you expect in the mother of the CF patient? A. 95 and 92 B. 149 C. 133 and 130 D. 149 and 146 E. 146

Answer 2

Question

Chapter 4, Problem 1PDT

a.

Summary Introduction

To determine: The primary eight amino acids for each of the given DNA sequences, which are given as follows:

ATGTCTCTCACCAACAAGAACGTCATGgCTCTCACCAACAAGAACGTCATGTCgCTCACCAACAAGAACGTCATGTCTtTgACCAACAAGAACGTCATGTCTCTCACCAACAAGAACGTg

Introduction: The given DNA sequences encode the initial eight amino acids for five alleles of the Adh protein in Drosophila pseudoobscura. Nucleotides that vary from the first sequence are shown by a lowercase letter. The sequences of DNA code for a number of alleles. The alleles are responsible for specific assignation of characters to the individual. There are a number of alleles that can be present within a gene. The genes are present in the chromosomes, and the chromosomes are present in pairs. Alleles are responsible for the genotypic character of the organism, which reflects in the phenotype of the organism.

a.

Expert Solution

Explanation of Solution

The given DNA sequences are as follows:

ATGTCTCTCACCAACAAGAACGTCATGgCTCTCACCAACAAGAACGTCATGTCgCTCACCAACAAGAACGTCATGTCTtTgACCAACAAGAACGTCATGTCTCTCACCAACAAGAACGTg

The amino acids from the above DNA sequences using the codon table are given below:

MetSerLeuThrAsnLysAsnVal MetAlaLeuThrAsnLysAsnVal MetSerLeuThrAsnLysAsnValMetSerLeuThrAsnLysAsnValMetSerLeuThrAsnLysAsnVal

b.

Summary Introduction

To determine: The five polymorphic sites and signify whether the site is represented by synonymous or non-synonymous polymorphisms in the given DNA sequences.

ATGTCTCTCACCAACAAGAACGTCATGgCTCTCACCAACAAGAACGTCATGTCgCTCACCAACAAGAACGTCATGTCTtTgACCAACAAGAACGTCATGTCTCTCACCAACAAGAACGTg

Introduction: The given DNA sequences encode the initial eight amino acids for five alleles of the Adh protein in Drosophila pseudoobscura. Nucleotides that vary from the first sequence are shown by a lowercase letter. The sequences of DNA code for a number of alleles. The alleles are responsible for specific assignation of characters to the individual. There are a number of alleles that can be present within a gene. The genes are present in the chromosomes, and the chromosomes are present in pairs. Alleles are responsible for the genotypic character of the organism, which reflects in the phenotype of the organism.

b.

Expert Solution

Explanation of Solution

The process of polymorphism results in the modification of the nucleotide. The “synonymous polymorphism” is defined as the production of the same type of amino acid after the modification in the nucleotide.

The synonymous or non-synonymous polymorphisms in sequences are as follows:

MetSerLeuThrAsnLysAsnVal - SynonymousMetAlaLeuThrAsnLysAsnVal - Non-synonymous MetSerLeuThrAsnLysAsnVal - SynonymousMetSerLeuThrAsnLysAsnVal - SynonymousMetSerLeuThrAsnLysAsnVal - Synonymous

The production of “alanine” in the second sequence fulfills the criteria of polymorphism.

c.

Summary Introduction

To determine: The one-difference intermediate in the production of TTG from CTC.

ATGTCTCTCACCAACAAGAACGTCATGgCTCTCACCAACAAGAACGTCATGTCgCTCACCAACAAGAACGTCATGTCTtTgACCAACAAGAACGTCATGTCTCTCACCAACAAGAACGTg

Introduction: The given DNA sequences encode the initial eight amino acids for five alleles of the Adh protein in Drosophila pseudoobscura. Nucleotides that vary from the first sequence are shown by a lowercase letter. The sequences of DNA code for a number of alleles. The alleles are responsible for specific assignation of characters to the individual. There are a number of alleles that can be present within a gene. The genes are present in the chromosomes, and the chromosomes are present in pairs. Alleles are responsible for the genotypic character of the organism, which reflects in the phenotype of the organism.

c.

Expert Solution

Explanation of Solution

According to the provided information, the CTC sequence is responsible for the production of TTG sequence. Both the codons code for “Leu.” However, the codon that could be the intermediate of the process could be the same as “leu.” TTC codes for the “Phe” when activated; hence, it cannot be the intermediate in the reaction. Hence, the one-difference intermediate must be CTG, which also codes for the “Leu” that forms the bridge in the production of TTG from the CTC codon.

d.

Summary Introduction

To determine: The reason that synonymous polymorphisms are likely to be more frequent than non-synonymous polymorphisms.

ATGTCTCTCACCAACAAGAACGTCATGgCTCTCACCAACAAGAACGTCATGTCgCTCACCAACAAGAACGTCATGTCTtTgACCAACAAGAACGTCATGTCTCTCACCAACAAGAACGTg

Introduction: The given DNA sequences encode the initial eight amino acids for five alleles of the Adh protein in Drosophila pseudoobscura. Nucleotides that vary from the first sequence are shown by a lowercase letter. The sequences of DNA code for a number of alleles. The alleles are responsible for specific assignation of characters to the individual. There are a number of alleles that can be present within a gene. The genes are present in the chromosomes, and the chromosomes are present in pairs. Alleles are responsible for the genotypic character of the organism, which reflects in the phenotype of the organism.

d.

Expert Solution

Explanation of Solution

There is a repetition of “3-letter codes” along the codon for the coding of specific amino acid. The production of new amino acid takes place when there is a change in the second element, resulting in non-synonymous polymorphism. However, changes in the third element of the codon give the similar amino acid. Thus, synonymous polymorphisms are likely to be more frequent than non-synonymous polymorphisms.

MetSerLeuThrAsnLysAsnVal - SynonymousMetAlaLeuThrAsnLysAsnVal - Non-synonymous MetSerLeuThrAsnLysAsnVal - SynonymousMetSerLeuThrAsnLysAsnVal - SynonymousMetSerLeuThrAsnLysAsnVal - Synonymous

Want to see more full solutions like this?

Subscribe now to access step-by-step solutions to millions of textbook problems written by subject matter experts!

Answer 3

Question

Chapter 4, Problem 1PDT

a.

Summary Introduction

To determine: The primary eight amino acids for each of the given DNA sequences, which are given as follows:

ATGTCTCTCACCAACAAGAACGTCATGgCTCTCACCAACAAGAACGTCATGTCgCTCACCAACAAGAACGTCATGTCTtTgACCAACAAGAACGTCATGTCTCTCACCAACAAGAACGTg

Introduction: The given DNA sequences encode the initial eight amino acids for five alleles of the Adh protein in Drosophila pseudoobscura. Nucleotides that vary from the first sequence are shown by a lowercase letter. The sequences of DNA code for a number of alleles. The alleles are responsible for specific assignation of characters to the individual. There are a number of alleles that can be present within a gene. The genes are present in the chromosomes, and the chromosomes are present in pairs. Alleles are responsible for the genotypic character of the organism, which reflects in the phenotype of the organism.

a.

Expert Solution

Explanation of Solution

The given DNA sequences are as follows:

ATGTCTCTCACCAACAAGAACGTCATGgCTCTCACCAACAAGAACGTCATGTCgCTCACCAACAAGAACGTCATGTCTtTgACCAACAAGAACGTCATGTCTCTCACCAACAAGAACGTg

The amino acids from the above DNA sequences using the codon table are given below:

MetSerLeuThrAsnLysAsnVal MetAlaLeuThrAsnLysAsnVal MetSerLeuThrAsnLysAsnValMetSerLeuThrAsnLysAsnValMetSerLeuThrAsnLysAsnVal

b.

Summary Introduction

To determine: The five polymorphic sites and signify whether the site is represented by synonymous or non-synonymous polymorphisms in the given DNA sequences.

ATGTCTCTCACCAACAAGAACGTCATGgCTCTCACCAACAAGAACGTCATGTCgCTCACCAACAAGAACGTCATGTCTtTgACCAACAAGAACGTCATGTCTCTCACCAACAAGAACGTg

Introduction: The given DNA sequences encode the initial eight amino acids for five alleles of the Adh protein in Drosophila pseudoobscura. Nucleotides that vary from the first sequence are shown by a lowercase letter. The sequences of DNA code for a number of alleles. The alleles are responsible for specific assignation of characters to the individual. There are a number of alleles that can be present within a gene. The genes are present in the chromosomes, and the chromosomes are present in pairs. Alleles are responsible for the genotypic character of the organism, which reflects in the phenotype of the organism.

b.

Expert Solution

Explanation of Solution

The process of polymorphism results in the modification of the nucleotide. The “synonymous polymorphism” is defined as the production of the same type of amino acid after the modification in the nucleotide.

The synonymous or non-synonymous polymorphisms in sequences are as follows:

MetSerLeuThrAsnLysAsnVal - SynonymousMetAlaLeuThrAsnLysAsnVal - Non-synonymous MetSerLeuThrAsnLysAsnVal - SynonymousMetSerLeuThrAsnLysAsnVal - SynonymousMetSerLeuThrAsnLysAsnVal - Synonymous

The production of “alanine” in the second sequence fulfills the criteria of polymorphism.

c.

Summary Introduction

To determine: The one-difference intermediate in the production of TTG from CTC.

ATGTCTCTCACCAACAAGAACGTCATGgCTCTCACCAACAAGAACGTCATGTCgCTCACCAACAAGAACGTCATGTCTtTgACCAACAAGAACGTCATGTCTCTCACCAACAAGAACGTg

Introduction: The given DNA sequences encode the initial eight amino acids for five alleles of the Adh protein in Drosophila pseudoobscura. Nucleotides that vary from the first sequence are shown by a lowercase letter. The sequences of DNA code for a number of alleles. The alleles are responsible for specific assignation of characters to the individual. There are a number of alleles that can be present within a gene. The genes are present in the chromosomes, and the chromosomes are present in pairs. Alleles are responsible for the genotypic character of the organism, which reflects in the phenotype of the organism.

c.

Expert Solution

Explanation of Solution

According to the provided information, the CTC sequence is responsible for the production of TTG sequence. Both the codons code for “Leu.” However, the codon that could be the intermediate of the process could be the same as “leu.” TTC codes for the “Phe” when activated; hence, it cannot be the intermediate in the reaction. Hence, the one-difference intermediate must be CTG, which also codes for the “Leu” that forms the bridge in the production of TTG from the CTC codon.

d.

Summary Introduction

To determine: The reason that synonymous polymorphisms are likely to be more frequent than non-synonymous polymorphisms.

ATGTCTCTCACCAACAAGAACGTCATGgCTCTCACCAACAAGAACGTCATGTCgCTCACCAACAAGAACGTCATGTCTtTgACCAACAAGAACGTCATGTCTCTCACCAACAAGAACGTg

Introduction: The given DNA sequences encode the initial eight amino acids for five alleles of the Adh protein in Drosophila pseudoobscura. Nucleotides that vary from the first sequence are shown by a lowercase letter. The sequences of DNA code for a number of alleles. The alleles are responsible for specific assignation of characters to the individual. There are a number of alleles that can be present within a gene. The genes are present in the chromosomes, and the chromosomes are present in pairs. Alleles are responsible for the genotypic character of the organism, which reflects in the phenotype of the organism.

d.

Expert Solution

Explanation of Solution

There is a repetition of “3-letter codes” along the codon for the coding of specific amino acid. The production of new amino acid takes place when there is a change in the second element, resulting in non-synonymous polymorphism. However, changes in the third element of the codon give the similar amino acid. Thus, synonymous polymorphisms are likely to be more frequent than non-synonymous polymorphisms.

MetSerLeuThrAsnLysAsnVal - SynonymousMetAlaLeuThrAsnLysAsnVal - Non-synonymous MetSerLeuThrAsnLysAsnVal - SynonymousMetSerLeuThrAsnLysAsnVal - SynonymousMetSerLeuThrAsnLysAsnVal - Synonymous

Want to see more full solutions like this?

Subscribe now to access step-by-step solutions to millions of textbook problems written by subject matter experts!

Answer 4

Question

Chapter 4, Problem 1PDT

a.

Summary Introduction

To determine: The primary eight amino acids for each of the given DNA sequences, which are given as follows:

ATGTCTCTCACCAACAAGAACGTCATGgCTCTCACCAACAAGAACGTCATGTCgCTCACCAACAAGAACGTCATGTCTtTgACCAACAAGAACGTCATGTCTCTCACCAACAAGAACGTg

Introduction: The given DNA sequences encode the initial eight amino acids for five alleles of the Adh protein in Drosophila pseudoobscura. Nucleotides that vary from the first sequence are shown by a lowercase letter. The sequences of DNA code for a number of alleles. The alleles are responsible for specific assignation of characters to the individual. There are a number of alleles that can be present within a gene. The genes are present in the chromosomes, and the chromosomes are present in pairs. Alleles are responsible for the genotypic character of the organism, which reflects in the phenotype of the organism.

a.

Expert Solution

Explanation of Solution

The given DNA sequences are as follows:

ATGTCTCTCACCAACAAGAACGTCATGgCTCTCACCAACAAGAACGTCATGTCgCTCACCAACAAGAACGTCATGTCTtTgACCAACAAGAACGTCATGTCTCTCACCAACAAGAACGTg

The amino acids from the above DNA sequences using the codon table are given below:

MetSerLeuThrAsnLysAsnVal MetAlaLeuThrAsnLysAsnVal MetSerLeuThrAsnLysAsnValMetSerLeuThrAsnLysAsnValMetSerLeuThrAsnLysAsnVal

b.

Summary Introduction

To determine: The five polymorphic sites and signify whether the site is represented by synonymous or non-synonymous polymorphisms in the given DNA sequences.

ATGTCTCTCACCAACAAGAACGTCATGgCTCTCACCAACAAGAACGTCATGTCgCTCACCAACAAGAACGTCATGTCTtTgACCAACAAGAACGTCATGTCTCTCACCAACAAGAACGTg

Introduction: The given DNA sequences encode the initial eight amino acids for five alleles of the Adh protein in Drosophila pseudoobscura. Nucleotides that vary from the first sequence are shown by a lowercase letter. The sequences of DNA code for a number of alleles. The alleles are responsible for specific assignation of characters to the individual. There are a number of alleles that can be present within a gene. The genes are present in the chromosomes, and the chromosomes are present in pairs. Alleles are responsible for the genotypic character of the organism, which reflects in the phenotype of the organism.

b.

Expert Solution

Explanation of Solution

The process of polymorphism results in the modification of the nucleotide. The “synonymous polymorphism” is defined as the production of the same type of amino acid after the modification in the nucleotide.

The synonymous or non-synonymous polymorphisms in sequences are as follows:

MetSerLeuThrAsnLysAsnVal - SynonymousMetAlaLeuThrAsnLysAsnVal - Non-synonymous MetSerLeuThrAsnLysAsnVal - SynonymousMetSerLeuThrAsnLysAsnVal - SynonymousMetSerLeuThrAsnLysAsnVal - Synonymous

The production of “alanine” in the second sequence fulfills the criteria of polymorphism.

c.

Summary Introduction

To determine: The one-difference intermediate in the production of TTG from CTC.

ATGTCTCTCACCAACAAGAACGTCATGgCTCTCACCAACAAGAACGTCATGTCgCTCACCAACAAGAACGTCATGTCTtTgACCAACAAGAACGTCATGTCTCTCACCAACAAGAACGTg

Introduction: The given DNA sequences encode the initial eight amino acids for five alleles of the Adh protein in Drosophila pseudoobscura. Nucleotides that vary from the first sequence are shown by a lowercase letter. The sequences of DNA code for a number of alleles. The alleles are responsible for specific assignation of characters to the individual. There are a number of alleles that can be present within a gene. The genes are present in the chromosomes, and the chromosomes are present in pairs. Alleles are responsible for the genotypic character of the organism, which reflects in the phenotype of the organism.

c.

Expert Solution

Explanation of Solution

According to the provided information, the CTC sequence is responsible for the production of TTG sequence. Both the codons code for “Leu.” However, the codon that could be the intermediate of the process could be the same as “leu.” TTC codes for the “Phe” when activated; hence, it cannot be the intermediate in the reaction. Hence, the one-difference intermediate must be CTG, which also codes for the “Leu” that forms the bridge in the production of TTG from the CTC codon.

d.

Summary Introduction

To determine: The reason that synonymous polymorphisms are likely to be more frequent than non-synonymous polymorphisms.

ATGTCTCTCACCAACAAGAACGTCATGgCTCTCACCAACAAGAACGTCATGTCgCTCACCAACAAGAACGTCATGTCTtTgACCAACAAGAACGTCATGTCTCTCACCAACAAGAACGTg

Introduction: The given DNA sequences encode the initial eight amino acids for five alleles of the Adh protein in Drosophila pseudoobscura. Nucleotides that vary from the first sequence are shown by a lowercase letter. The sequences of DNA code for a number of alleles. The alleles are responsible for specific assignation of characters to the individual. There are a number of alleles that can be present within a gene. The genes are present in the chromosomes, and the chromosomes are present in pairs. Alleles are responsible for the genotypic character of the organism, which reflects in the phenotype of the organism.

d.

Expert Solution

Explanation of Solution

There is a repetition of “3-letter codes” along the codon for the coding of specific amino acid. The production of new amino acid takes place when there is a change in the second element, resulting in non-synonymous polymorphism. However, changes in the third element of the codon give the similar amino acid. Thus, synonymous polymorphisms are likely to be more frequent than non-synonymous polymorphisms.

MetSerLeuThrAsnLysAsnVal - SynonymousMetAlaLeuThrAsnLysAsnVal - Non-synonymous MetSerLeuThrAsnLysAsnVal - SynonymousMetSerLeuThrAsnLysAsnVal - SynonymousMetSerLeuThrAsnLysAsnVal - Synonymous

Want to see more full solutions like this?

Subscribe now to access step-by-step solutions to millions of textbook problems written by subject matter experts!

Answer 5

Chapter 4, Problem 1PDT

a.

Summary Introduction

To determine: The primary eight amino acids for each of the given DNA sequences, which are given as follows:

ATGTCTCTCACCAACAAGAACGTCATGgCTCTCACCAACAAGAACGTCATGTCgCTCACCAACAAGAACGTCATGTCTtTgACCAACAAGAACGTCATGTCTCTCACCAACAAGAACGTg

Introduction: The given DNA sequences encode the initial eight amino acids for five alleles of the Adh protein in Drosophila pseudoobscura. Nucleotides that vary from the first sequence are shown by a lowercase letter. The sequences of DNA code for a number of alleles. The alleles are responsible for specific assignation of characters to the individual. There are a number of alleles that can be present within a gene. The genes are present in the chromosomes, and the chromosomes are present in pairs. Alleles are responsible for the genotypic character of the organism, which reflects in the phenotype of the organism.

a.

Expert Solution

Explanation of Solution

The given DNA sequences are as follows:

ATGTCTCTCACCAACAAGAACGTCATGgCTCTCACCAACAAGAACGTCATGTCgCTCACCAACAAGAACGTCATGTCTtTgACCAACAAGAACGTCATGTCTCTCACCAACAAGAACGTg

The amino acids from the above DNA sequences using the codon table are given below:

MetSerLeuThrAsnLysAsnVal MetAlaLeuThrAsnLysAsnVal MetSerLeuThrAsnLysAsnValMetSerLeuThrAsnLysAsnValMetSerLeuThrAsnLysAsnVal

b.

Summary Introduction

To determine: The five polymorphic sites and signify whether the site is represented by synonymous or non-synonymous polymorphisms in the given DNA sequences.

ATGTCTCTCACCAACAAGAACGTCATGgCTCTCACCAACAAGAACGTCATGTCgCTCACCAACAAGAACGTCATGTCTtTgACCAACAAGAACGTCATGTCTCTCACCAACAAGAACGTg

Introduction: The given DNA sequences encode the initial eight amino acids for five alleles of the Adh protein in Drosophila pseudoobscura. Nucleotides that vary from the first sequence are shown by a lowercase letter. The sequences of DNA code for a number of alleles. The alleles are responsible for specific assignation of characters to the individual. There are a number of alleles that can be present within a gene. The genes are present in the chromosomes, and the chromosomes are present in pairs. Alleles are responsible for the genotypic character of the organism, which reflects in the phenotype of the organism.

b.

Expert Solution

Explanation of Solution

The process of polymorphism results in the modification of the nucleotide. The “synonymous polymorphism” is defined as the production of the same type of amino acid after the modification in the nucleotide.

The synonymous or non-synonymous polymorphisms in sequences are as follows:

MetSerLeuThrAsnLysAsnVal - SynonymousMetAlaLeuThrAsnLysAsnVal - Non-synonymous MetSerLeuThrAsnLysAsnVal - SynonymousMetSerLeuThrAsnLysAsnVal - SynonymousMetSerLeuThrAsnLysAsnVal - Synonymous

The production of “alanine” in the second sequence fulfills the criteria of polymorphism.

c.

Summary Introduction

To determine: The one-difference intermediate in the production of TTG from CTC.

ATGTCTCTCACCAACAAGAACGTCATGgCTCTCACCAACAAGAACGTCATGTCgCTCACCAACAAGAACGTCATGTCTtTgACCAACAAGAACGTCATGTCTCTCACCAACAAGAACGTg

Introduction: The given DNA sequences encode the initial eight amino acids for five alleles of the Adh protein in Drosophila pseudoobscura. Nucleotides that vary from the first sequence are shown by a lowercase letter. The sequences of DNA code for a number of alleles. The alleles are responsible for specific assignation of characters to the individual. There are a number of alleles that can be present within a gene. The genes are present in the chromosomes, and the chromosomes are present in pairs. Alleles are responsible for the genotypic character of the organism, which reflects in the phenotype of the organism.

c.

Expert Solution

Explanation of Solution

According to the provided information, the CTC sequence is responsible for the production of TTG sequence. Both the codons code for “Leu.” However, the codon that could be the intermediate of the process could be the same as “leu.” TTC codes for the “Phe” when activated; hence, it cannot be the intermediate in the reaction. Hence, the one-difference intermediate must be CTG, which also codes for the “Leu” that forms the bridge in the production of TTG from the CTC codon.

d.

Summary Introduction

To determine: The reason that synonymous polymorphisms are likely to be more frequent than non-synonymous polymorphisms.

ATGTCTCTCACCAACAAGAACGTCATGgCTCTCACCAACAAGAACGTCATGTCgCTCACCAACAAGAACGTCATGTCTtTgACCAACAAGAACGTCATGTCTCTCACCAACAAGAACGTg

Introduction: The given DNA sequences encode the initial eight amino acids for five alleles of the Adh protein in Drosophila pseudoobscura. Nucleotides that vary from the first sequence are shown by a lowercase letter. The sequences of DNA code for a number of alleles. The alleles are responsible for specific assignation of characters to the individual. There are a number of alleles that can be present within a gene. The genes are present in the chromosomes, and the chromosomes are present in pairs. Alleles are responsible for the genotypic character of the organism, which reflects in the phenotype of the organism.

d.

Expert Solution

Explanation of Solution

There is a repetition of “3-letter codes” along the codon for the coding of specific amino acid. The production of new amino acid takes place when there is a change in the second element, resulting in non-synonymous polymorphism. However, changes in the third element of the codon give the similar amino acid. Thus, synonymous polymorphisms are likely to be more frequent than non-synonymous polymorphisms.

MetSerLeuThrAsnLysAsnVal - SynonymousMetAlaLeuThrAsnLysAsnVal - Non-synonymous MetSerLeuThrAsnLysAsnVal - SynonymousMetSerLeuThrAsnLysAsnVal - SynonymousMetSerLeuThrAsnLysAsnVal - Synonymous

Answer 6

Chapter 4, Problem 1PDT

a.

Summary Introduction

To determine: The primary eight amino acids for each of the given DNA sequences, which are given as follows:

ATGTCTCTCACCAACAAGAACGTCATGgCTCTCACCAACAAGAACGTCATGTCgCTCACCAACAAGAACGTCATGTCTtTgACCAACAAGAACGTCATGTCTCTCACCAACAAGAACGTg

Introduction: The given DNA sequences encode the initial eight amino acids for five alleles of the Adh protein in Drosophila pseudoobscura. Nucleotides that vary from the first sequence are shown by a lowercase letter. The sequences of DNA code for a number of alleles. The alleles are responsible for specific assignation of characters to the individual. There are a number of alleles that can be present within a gene. The genes are present in the chromosomes, and the chromosomes are present in pairs. Alleles are responsible for the genotypic character of the organism, which reflects in the phenotype of the organism.

a.

Expert Solution

Explanation of Solution

The given DNA sequences are as follows:

ATGTCTCTCACCAACAAGAACGTCATGgCTCTCACCAACAAGAACGTCATGTCgCTCACCAACAAGAACGTCATGTCTtTgACCAACAAGAACGTCATGTCTCTCACCAACAAGAACGTg

The amino acids from the above DNA sequences using the codon table are given below:

MetSerLeuThrAsnLysAsnVal MetAlaLeuThrAsnLysAsnVal MetSerLeuThrAsnLysAsnValMetSerLeuThrAsnLysAsnValMetSerLeuThrAsnLysAsnVal

Answer 7

Chapter 4, Problem 1PDT

a.

Summary Introduction

To determine: The primary eight amino acids for each of the given DNA sequences, which are given as follows:

ATGTCTCTCACCAACAAGAACGTCATGgCTCTCACCAACAAGAACGTCATGTCgCTCACCAACAAGAACGTCATGTCTtTgACCAACAAGAACGTCATGTCTCTCACCAACAAGAACGTg

Introduction: The given DNA sequences encode the initial eight amino acids for five alleles of the Adh protein in Drosophila pseudoobscura. Nucleotides that vary from the first sequence are shown by a lowercase letter. The sequences of DNA code for a number of alleles. The alleles are responsible for specific assignation of characters to the individual. There are a number of alleles that can be present within a gene. The genes are present in the chromosomes, and the chromosomes are present in pairs. Alleles are responsible for the genotypic character of the organism, which reflects in the phenotype of the organism.

Answer 8

a.

Expert Solution

Explanation of Solution

The given DNA sequences are as follows:

ATGTCTCTCACCAACAAGAACGTCATGgCTCTCACCAACAAGAACGTCATGTCgCTCACCAACAAGAACGTCATGTCTtTgACCAACAAGAACGTCATGTCTCTCACCAACAAGAACGTg

The amino acids from the above DNA sequences using the codon table are given below:

MetSerLeuThrAsnLysAsnVal MetAlaLeuThrAsnLysAsnVal MetSerLeuThrAsnLysAsnValMetSerLeuThrAsnLysAsnValMetSerLeuThrAsnLysAsnVal

Answer 9

a.

Expert Solution

Answer 10

a.

Expert Solution

Answer 11

Expert Solution

Answer 12

b.

Summary Introduction

To determine: The five polymorphic sites and signify whether the site is represented by synonymous or non-synonymous polymorphisms in the given DNA sequences.

ATGTCTCTCACCAACAAGAACGTCATGgCTCTCACCAACAAGAACGTCATGTCgCTCACCAACAAGAACGTCATGTCTtTgACCAACAAGAACGTCATGTCTCTCACCAACAAGAACGTg

Introduction: The given DNA sequences encode the initial eight amino acids for five alleles of the Adh protein in Drosophila pseudoobscura. Nucleotides that vary from the first sequence are shown by a lowercase letter. The sequences of DNA code for a number of alleles. The alleles are responsible for specific assignation of characters to the individual. There are a number of alleles that can be present within a gene. The genes are present in the chromosomes, and the chromosomes are present in pairs. Alleles are responsible for the genotypic character of the organism, which reflects in the phenotype of the organism.

b.

Expert Solution

Explanation of Solution

The process of polymorphism results in the modification of the nucleotide. The “synonymous polymorphism” is defined as the production of the same type of amino acid after the modification in the nucleotide.

The synonymous or non-synonymous polymorphisms in sequences are as follows:

MetSerLeuThrAsnLysAsnVal - SynonymousMetAlaLeuThrAsnLysAsnVal - Non-synonymous MetSerLeuThrAsnLysAsnVal - SynonymousMetSerLeuThrAsnLysAsnVal - SynonymousMetSerLeuThrAsnLysAsnVal - Synonymous

The production of “alanine” in the second sequence fulfills the criteria of polymorphism.

Answer 13

b.

Summary Introduction

To determine: The five polymorphic sites and signify whether the site is represented by synonymous or non-synonymous polymorphisms in the given DNA sequences.

ATGTCTCTCACCAACAAGAACGTCATGgCTCTCACCAACAAGAACGTCATGTCgCTCACCAACAAGAACGTCATGTCTtTgACCAACAAGAACGTCATGTCTCTCACCAACAAGAACGTg

Introduction: The given DNA sequences encode the initial eight amino acids for five alleles of the Adh protein in Drosophila pseudoobscura. Nucleotides that vary from the first sequence are shown by a lowercase letter. The sequences of DNA code for a number of alleles. The alleles are responsible for specific assignation of characters to the individual. There are a number of alleles that can be present within a gene. The genes are present in the chromosomes, and the chromosomes are present in pairs. Alleles are responsible for the genotypic character of the organism, which reflects in the phenotype of the organism.

Answer 14

b.

Expert Solution

Explanation of Solution

The process of polymorphism results in the modification of the nucleotide. The “synonymous polymorphism” is defined as the production of the same type of amino acid after the modification in the nucleotide.

The synonymous or non-synonymous polymorphisms in sequences are as follows:

MetSerLeuThrAsnLysAsnVal - SynonymousMetAlaLeuThrAsnLysAsnVal - Non-synonymous MetSerLeuThrAsnLysAsnVal - SynonymousMetSerLeuThrAsnLysAsnVal - SynonymousMetSerLeuThrAsnLysAsnVal - Synonymous

The production of “alanine” in the second sequence fulfills the criteria of polymorphism.

Answer 15

b.

Expert Solution

Answer 16

b.

Expert Solution

Answer 17

Expert Solution

Answer 18

c.

Summary Introduction

To determine: The one-difference intermediate in the production of TTG from CTC.

ATGTCTCTCACCAACAAGAACGTCATGgCTCTCACCAACAAGAACGTCATGTCgCTCACCAACAAGAACGTCATGTCTtTgACCAACAAGAACGTCATGTCTCTCACCAACAAGAACGTg

Introduction: The given DNA sequences encode the initial eight amino acids for five alleles of the Adh protein in Drosophila pseudoobscura. Nucleotides that vary from the first sequence are shown by a lowercase letter. The sequences of DNA code for a number of alleles. The alleles are responsible for specific assignation of characters to the individual. There are a number of alleles that can be present within a gene. The genes are present in the chromosomes, and the chromosomes are present in pairs. Alleles are responsible for the genotypic character of the organism, which reflects in the phenotype of the organism.

c.

Expert Solution

Explanation of Solution

According to the provided information, the CTC sequence is responsible for the production of TTG sequence. Both the codons code for “Leu.” However, the codon that could be the intermediate of the process could be the same as “leu.” TTC codes for the “Phe” when activated; hence, it cannot be the intermediate in the reaction. Hence, the one-difference intermediate must be CTG, which also codes for the “Leu” that forms the bridge in the production of TTG from the CTC codon.

Answer 19

c.

Summary Introduction

To determine: The one-difference intermediate in the production of TTG from CTC.

ATGTCTCTCACCAACAAGAACGTCATGgCTCTCACCAACAAGAACGTCATGTCgCTCACCAACAAGAACGTCATGTCTtTgACCAACAAGAACGTCATGTCTCTCACCAACAAGAACGTg

Introduction: The given DNA sequences encode the initial eight amino acids for five alleles of the Adh protein in Drosophila pseudoobscura. Nucleotides that vary from the first sequence are shown by a lowercase letter. The sequences of DNA code for a number of alleles. The alleles are responsible for specific assignation of characters to the individual. There are a number of alleles that can be present within a gene. The genes are present in the chromosomes, and the chromosomes are present in pairs. Alleles are responsible for the genotypic character of the organism, which reflects in the phenotype of the organism.

Answer 20

c.

Expert Solution

Explanation of Solution

According to the provided information, the CTC sequence is responsible for the production of TTG sequence. Both the codons code for “Leu.” However, the codon that could be the intermediate of the process could be the same as “leu.” TTC codes for the “Phe” when activated; hence, it cannot be the intermediate in the reaction. Hence, the one-difference intermediate must be CTG, which also codes for the “Leu” that forms the bridge in the production of TTG from the CTC codon.

Answer 21

c.

Expert Solution

Answer 22

c.

Expert Solution

Answer 23

Expert Solution

Answer 24

d.

Summary Introduction

To determine: The reason that synonymous polymorphisms are likely to be more frequent than non-synonymous polymorphisms.

ATGTCTCTCACCAACAAGAACGTCATGgCTCTCACCAACAAGAACGTCATGTCgCTCACCAACAAGAACGTCATGTCTtTgACCAACAAGAACGTCATGTCTCTCACCAACAAGAACGTg

Introduction: The given DNA sequences encode the initial eight amino acids for five alleles of the Adh protein in Drosophila pseudoobscura. Nucleotides that vary from the first sequence are shown by a lowercase letter. The sequences of DNA code for a number of alleles. The alleles are responsible for specific assignation of characters to the individual. There are a number of alleles that can be present within a gene. The genes are present in the chromosomes, and the chromosomes are present in pairs. Alleles are responsible for the genotypic character of the organism, which reflects in the phenotype of the organism.

d.

Expert Solution

Explanation of Solution

There is a repetition of “3-letter codes” along the codon for the coding of specific amino acid. The production of new amino acid takes place when there is a change in the second element, resulting in non-synonymous polymorphism. However, changes in the third element of the codon give the similar amino acid. Thus, synonymous polymorphisms are likely to be more frequent than non-synonymous polymorphisms.

MetSerLeuThrAsnLysAsnVal - SynonymousMetAlaLeuThrAsnLysAsnVal - Non-synonymous MetSerLeuThrAsnLysAsnVal - SynonymousMetSerLeuThrAsnLysAsnVal - SynonymousMetSerLeuThrAsnLysAsnVal - Synonymous

Answer 25

d.

Summary Introduction

To determine: The reason that synonymous polymorphisms are likely to be more frequent than non-synonymous polymorphisms.

ATGTCTCTCACCAACAAGAACGTCATGgCTCTCACCAACAAGAACGTCATGTCgCTCACCAACAAGAACGTCATGTCTtTgACCAACAAGAACGTCATGTCTCTCACCAACAAGAACGTg

Introduction: The given DNA sequences encode the initial eight amino acids for five alleles of the Adh protein in Drosophila pseudoobscura. Nucleotides that vary from the first sequence are shown by a lowercase letter. The sequences of DNA code for a number of alleles. The alleles are responsible for specific assignation of characters to the individual. There are a number of alleles that can be present within a gene. The genes are present in the chromosomes, and the chromosomes are present in pairs. Alleles are responsible for the genotypic character of the organism, which reflects in the phenotype of the organism.

Answer 26

d.

Expert Solution

Explanation of Solution

There is a repetition of “3-letter codes” along the codon for the coding of specific amino acid. The production of new amino acid takes place when there is a change in the second element, resulting in non-synonymous polymorphism. However, changes in the third element of the codon give the similar amino acid. Thus, synonymous polymorphisms are likely to be more frequent than non-synonymous polymorphisms.

MetSerLeuThrAsnLysAsnVal - SynonymousMetAlaLeuThrAsnLysAsnVal - Non-synonymous MetSerLeuThrAsnLysAsnVal - SynonymousMetSerLeuThrAsnLysAsnVal - SynonymousMetSerLeuThrAsnLysAsnVal - Synonymous