Concept explainers
(1)
To determine: The first start codon in the given DNA (deoxyribonucleic acid) strand.
Introduction: There are two type of nucleic acid: DNA and RNA. Both the
(2)
To determine: The sequence of complementary mRNA (messenger ribonucleic acid) bases following the start codon.
Introduction: RNA is essential
(3)
To determine: The amino acids translated by the given mRNA triplets.
Introduction: Amino acids are the building blocks of proteins. There are 22 standard amino acids that are involved in formation of proteins. these amino acids are encoded by specific mRNA codons.
![Check Mark](/static/check-mark.png)
Want to see the full answer?
Check out a sample textbook solution![Blurred answer](/static/blurred-answer.jpg)
Chapter 4 Solutions
HUMAN PHYSIOLOGY: AN INTEG ACCESS C
- Identify the features of tRNA that are important in decoding genetic information and converting it into protein language.arrow_forwardThe peptide hormone oxytocin induces labor by stimulating the concentration of uterine smooth muscle. Its amino acid sequence is as follows: Cys-Tyr-Ile-Gln-Asn-Cys-Pro-Leu-Gly.Write a messenger RNA sequence for that sequence. Write the sequence of the two strands of DNA nucleotides that carry the information. for that protein.arrow_forwardAssume the first nucleotide in the sequence is at the +1 position. Transcribe the DNA sequence into mRNA and then translate it into the polypeptide. Give the polypeptide sequence in the following form: Met-Thr-Trp-Tyr-Val etc. 5' ACCGAAGGACTTATGGAGCGCTCATGATTTGCT 3'arrow_forward
- A strand of DNA contains this nucleotide sequence: TACTGCCTCCCCATAAGAATT. The corresponding nucleotide sequence of the mRNA strand from this DNA template is as follows: AUGACGGAGGGGUAUUCUUAA. Q: What is the amino acid sequence of the polypeptide that is produced form the mRNA strand? As well, draw a labelled diagram of the mRNA molecule being transcribed from this strand of DNA.arrow_forwarda) Identify three types of RNA and provide a description of each and the role they play in protein synthesis. (6 marks) b) Use the DNA sequence below to answer the following questions. 3' - TACGAACGAGTGCCCCAAAATT -5' What is the complementary DNA strand? (1 mark) What is the nucleotide sequence of the mRNA strand transcribed from the initial DNA strand? (1 mark) Provide an alternative mRNA sequence with four changes that would translate to the same amino acid sequence. (2 marks) Paragraph I A + v ... Lato (Recom... v 19px ... v Add a File Record Audio Record Video MacBook Pro G Search or type URL #3 2$ & ( 3 4 7 8 9 山訓 < COarrow_forwardThis activity breaks down protein synthesis using the metaphor of PIZZA! Use your Amino Acids Reference Sheet to complete the following table. Fill in the blank spaces of each row with either the missing DNA triplet, the mRNA codon, or the Amino Acid. While there are actually multiple codons that code for any one amino acid, for this activity there only needs to be one DNA triplet and one corresponding mRNA codon recorded for each amino acid. Remember: RNA uses uracil (U) instead of thymine (T)! TTG GGG CGT AAA TTT CAA DNA AAC UAU CAC GCA AAA mRNA codon Asparagine Proline Tyrosine Amino Acid Histidinearrow_forward
- An mRNA has the following base sequence:5′–CAGGCGGCGAUGGACAAUAAAGCGGGCCUGUAAGC–3′Identify the start codon, and determine the complete amino acid sequence that will be translated from this mRNA.arrow_forwardPlease help me find the protein sequence in reference to the text below. "mRNA Sequence Translate the mRNA sequence of HbS. 5'-AUG GUG CAC CUG ACU CCU GUG GAG AAG UCU GCC GUU ACU - 3¹ Protein Sequence 5'-"arrow_forwardThe template strand of a double helical segment of DNA consists of the following sequence: 5’-GTAGCCTTAAGCGATCACCGTCCGTATTACTAGTGGCCAGACTCTTTTCACTCTCATGTATAGTTG-3’ What is the nucleotide order in the complementary mRNA that can be transcribed from the given DNA strand?arrow_forward
- Describe the specificity between the amino acid carried by a tRNA and a codon in mRNA.arrow_forwardBriefly describe (two or three sentences) the role of tRNA in building a protein from mRNA.arrow_forwardGiven the following non-coding strand of DNA nucleotides:G T T C C C T T T G G A A C C T G G Write the nucleotide sequence of the coding strand of DNA:b. Write the nucleotide sequence of mRNA resulting from transcription:c. Using the genetic code, write the amino acid sequence translated:arrow_forward
- Biology Today and Tomorrow without Physiology (Mi...BiologyISBN:9781305117396Author:Cecie Starr, Christine Evers, Lisa StarrPublisher:Cengage LearningBiology (MindTap Course List)BiologyISBN:9781337392938Author:Eldra Solomon, Charles Martin, Diana W. Martin, Linda R. BergPublisher:Cengage Learning
![Text book image](https://www.bartleby.com/isbn_cover_images/9781305117396/9781305117396_smallCoverImage.gif)
![Text book image](https://www.bartleby.com/isbn_cover_images/9781337392938/9781337392938_smallCoverImage.gif)