Mastering Microbiology with Pearson eText -- Standalone Access Card -- for Brock Biology of Microorganisms (15th Edition)
15th Edition
ISBN: 9780134603971
Author: Michael T. Madigan, Kelly S. Bender, Daniel H. Buckley, W. Matthew Sattley, David A. Stahl
Publisher: PEARSON
expand_more
expand_more
format_list_bulleted
Concept explainers
Textbook Question
Chapter 4, Problem 3AQ
What would be the result (in terms of protein synthesis) if RNA polymerase initiated transcription one base upstream of its normal starting point? Why? By inspecting Table 4.4, discuss how the genetic code has evolved to help minimize the impact of mutations.
Expert Solution & Answer
Want to see the full answer?
Check out a sample textbook solutionStudents have asked these similar questions
What happens when one base pair of DNA is lost from the coding region of a gene because of mutation? First explain how this would affect the mRNA sequence, and second, explain how this would alter the amino acid of the protein that is encoded.
Why is it important for a transcription factor/activator to have a high affinity for a specific DNA sequence?
If a mutation occurred in the pRM promoter that rendered this promoter as ‘nonfunctional and unable to allow for transcription to occur’, what would be the outcome?
Chapter 4 Solutions
Mastering Microbiology with Pearson eText -- Standalone Access Card -- for Brock Biology of Microorganisms (15th Edition)
Ch. 4.1 - What is a genome and what is it composed of? What...Ch. 4.1 - Define the terms complementary and antiparallel as...Ch. 4.1 - Why is supercoiling essential to a bacterial cell?...Ch. 4.1 - Describe the central dogma of molecular biology....Ch. 4.2 - Approximately how large is the Escherichia coli...Ch. 4.2 - Prob. 2MQCh. 4.2 - Prob. 3MQCh. 4.2 - Prob. 1CRCh. 4.3 - Prob. 1MQCh. 4.3 - To which end (5 or 3) of a newly synthesized...
Ch. 4.3 - Prob. 3MQCh. 4.3 - What are the functions of DNA Pol I and III and...Ch. 4.3 - What is meant by the term semiconservative...Ch. 4.4 - Prob. 1MQCh. 4.4 - Prob. 2MQCh. 4.4 - Prob. 3MQCh. 4.4 - Prob. 1CRCh. 4.5 - What enzyme catalyzes transcription? What is a...Ch. 4.5 - Prob. 2MQCh. 4.5 - Prob. 3MQCh. 4.5 - Prob. 4MQCh. 4.5 - Prob. 1CRCh. 4.6 - What three major components make up an archaeal...Ch. 4.6 - Prob. 2MQCh. 4.6 - Prob. 3MQCh. 4.6 - How does the archaeal RNA polymerase differ from...Ch. 4.7 - Prob. 1MQCh. 4.7 - Differentiate between the different classes of...Ch. 4.7 - Prob. 3MQCh. 4.7 - Describe the two types of secondary structure a...Ch. 4.8 - Prob. 1MQCh. 4.8 - What is the function of the acceptor stem of a...Ch. 4.8 - Prob. 3MQCh. 4.8 - Prob. 1CRCh. 4.9 - Prob. 1MQCh. 4.9 - Prob. 2MQCh. 4.9 - Prob. 3MQCh. 4.9 - Why is the genetic code a degenerate code? What is...Ch. 4.10 - What are the components of a ribosome? What...Ch. 4.10 - How is a completed polypeptide chain released from...Ch. 4.10 - How does tmRNA free stalled ribosomes?Ch. 4.10 - Where on the ribosome do tRNAs bind, and what is...Ch. 4.11 - What are molecular chaperones and why are they...Ch. 4.11 - What macromolecules are protected by heat shock...Ch. 4.11 - How do chaperones assist the Escherichia coli cell...Ch. 4.11 - What proteins are involved in refolding misfolded...Ch. 4.12 - Prob. 1MQCh. 4.12 - Prob. 2MQCh. 4.12 - Prob. 3MQCh. 4.12 - Prob. 1CRCh. 4.13 - Prob. 1MQCh. 4.13 - Prob. 2MQCh. 4.13 - Prob. 3MQCh. 4.13 - Prob. 1CRCh. 4 - The genome of the bacterium Neisseria gonorrhoeae...Ch. 4 - Compare and contrast the activity of DNA and RNA...Ch. 4 - What would be the result (in terms of protein...
Knowledge Booster
Learn more about
Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.Similar questions
- What are the role of Transcription proteins? Explain this in 500 words, explain at your own wordsarrow_forwardWhy do you think the DNA must be unzipped before it is transcribed into messenger RNA?arrow_forwardWhich statement describes a difference between transcription in eukaryotic and prokaryotic cells? In eukaryotes, transcription occurs simultaneously with translation, while transcription in prokaryotes must complete before translation can begin. In eukaryotes, transcription is completed by an RNA polymerase, while transcription in prokaryotes is completed with a DNA polymerase. In eukaryotes, transcription produces an RNA molecule, while transcription in prokaryotes produces a DNA molecule. In eukaryotes, transcription produces a monocistronic RNA, while transcription in prokaryotes produces a polycistronic RNA. In eukaryotes, transcription produces an DNA molecule, while transcription in prokaryotes produces a RNA molecule.arrow_forward
- Why is it advantageous to have a mechanism to override the effect of stop codons in protein synthesis?arrow_forwardwhat is the role of rna polymerase? Does it catalyzes the polymerization step (adding new nucleotide to rna) in transcription?arrow_forwardWhich of the following DNA strands, the top or bottom, would serve as a template for RNA transcription if the DNA molecule were to unwind in the indicated direction? 5′ ACGGACTGTACCGCTGAAGTCATGGACGCTCGA 3′ 3′ TGCCTGACATGGCGACTTCAGTACCTGCGAGCT 5′ ⎯⎯⎯⎯→ Direction of DNA unwinding What would be the resulting RNA sequence (written 5′→3′ )?arrow_forward
- in a eukaryote cell, what do we call the DNA sequence that the specific transcription factor binds toarrow_forwardWhat is the survival value of the degeneracy of the genetic code? – Define what degeneracy means and then comment on why it would have survival value.arrow_forwardThe human rhodopsin gene is 2675 nucleotides long from transcription start site to transcription stop site. The human rhodopsin protein is 348 amino acids. What is the length of the mature mRNA (starting at the start codon and ending at the stop codon) from which the rhodopsin protein is synthesized? Explain how you reached your answer, including information about introns, exons, and splicing.arrow_forward
- What are the specific steps of eukaryotic transcription? Be sure in your discussion that you include the following terms: template strand, non-template strand, initiation, elongation, termination, promoter region, RNA polymerase, termination signal.arrow_forwardHere is a eukaryotic gene. The numbers given are base pairs of exon and intron. How long in bases will the pre mRNA transcript be? Explain briefly. What is the maximum number of amino acids that could make up the protein product from the final mRNA? Explain briefly.arrow_forwardWhy will a mistake in the RNA code alone not become a mutation?arrow_forward
arrow_back_ios
SEE MORE QUESTIONS
arrow_forward_ios
Recommended textbooks for you
- Human Heredity: Principles and Issues (MindTap Co...BiologyISBN:9781305251052Author:Michael CummingsPublisher:Cengage LearningBiology Today and Tomorrow without Physiology (Mi...BiologyISBN:9781305117396Author:Cecie Starr, Christine Evers, Lisa StarrPublisher:Cengage Learning
Human Heredity: Principles and Issues (MindTap Co...
Biology
ISBN:9781305251052
Author:Michael Cummings
Publisher:Cengage Learning
Biology Today and Tomorrow without Physiology (Mi...
Biology
ISBN:9781305117396
Author:Cecie Starr, Christine Evers, Lisa Starr
Publisher:Cengage Learning
QCE Biology: Introduction to Gene Expression; Author: Atomi;https://www.youtube.com/watch?v=a7hydUtCIJk;License: Standard YouTube License, CC-BY