Microbiology: An Evolving Science (Fourth Edition)
4th Edition
ISBN: 9780393615098
Author: John W. Foster, Joan L. Slonczewski
Publisher: W. W. Norton & Company
expand_more
expand_more
format_list_bulleted
Concept explainers
Question
Chapter 4.4, Problem 2TQ
Summary Introduction
To analyze:
The time taken to fall ill in the provided scenario.
Introduction:
There are various factors that must be taken into consideration while calculating the microbial population in different conditions. Each type of species of the microorganism takes a different time in order to become double or produce offspring. The microorganisms undergo division through various processes such as binary fission, budding, and multiple fission.
Expert Solution & Answer
Want to see the full answer?
Check out a sample textbook solutionStudents have asked these similar questions
In eukaryotes, the DNA replication rate is 50 nucleotides per second. How long would the replication of a chromosome of 150 million base pairs take if eukaryotic chromosomes were replicated like those of prokaryotes? Actually, eukaryotic replication takes only several hours. How do eukaryotes achieve this high rate?
Approximately how many high-energy bonds does DNA polymerase use to replicate a bacterial chromosome (ignoring helicase and other enzymes associated with the replication fork)? compared with its own dry weight of 10–12 g, how much glucose does a single bacterium need to provide enough energy to copy its DNA once?
Suppose that replication is initiated in a medium containing moderately radioactive tritiated thymine. After a few minutes of incubation, the bacteria are transferred to a medium containing highly radioactive tritiated thymidine. Sketch the autoradiographic pattern that would be seen for (a) undirectional replication and (b) bidirectional replication, each from a single origin.
Chapter 4 Solutions
Microbiology: An Evolving Science (Fourth Edition)
Ch. 4.1 - Prob. 1TQCh. 4.2 - Prob. 1TQCh. 4.2 - Prob. 2TQCh. 4.3 - Prob. 1TQCh. 4.3 - Prob. 2TQCh. 4.3 - Prob. 3TQCh. 4.3 - Prob. 4TQCh. 4.4 - Prob. 1TQCh. 4.4 - Prob. 2TQCh. 4.4 - Prob. 3TQ
Ch. 4.4 - Prob. 4TQCh. 4.4 - Prob. 5TQCh. 4.4 - Prob. 6TQCh. 4.4 - Prob. 7TQCh. 4.4 - Prob. 8TQCh. 4.6 - Prob. 1TQCh. 4 - Prob. 1RQCh. 4 - Prob. 2RQCh. 4 - Prob. 3RQCh. 4 - Prob. 4RQCh. 4 - Prob. 5RQCh. 4 - Prob. 6RQCh. 4 - Prob. 7RQCh. 4 - Prob. 8RQCh. 4 - Prob. 9RQCh. 4 - Prob. 1TQCh. 4 - Prob. 2TQCh. 4 - Prob. 3TQCh. 4 - Prob. 4TQCh. 4 - Prob. 5TQCh. 4 - Prob. 6TQCh. 4 - Prob. 7TQ
Knowledge Booster
Learn more about
Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.Similar questions
- If deoxyribonucleotides that lack the 3’-OH groups are added during the replication process, what do you expect will occur? Describe what happens when a nonsense mutation is introduced into the gene encoding transposase within a transposon. A pure culture of an unknown bacterium was streaked onto plates of a variety of media. You notice that the colony morphology is strikingly different on plates of minimal media with glucose compared to that seen on trypticase soy agar plates. How can you explain these differences in colony morphology?arrow_forwardThe above experiment, on DNA synthesis in the intact chromosomes of E. coli (with no virus infection), demonstrates which of the following forms of DNA replication? completely discontinuous replication completely conservative replication completely dispersive replication semi-discontinuous replication semi-conservative replicationarrow_forwardThe proteins and enzymes listed below are all required for DNA replication in E. coli, but they are listed in a random order. Determine the correct order in which they function in replication, by selecting the correct number from the drop-down menu in each case, with 1 being first and 6 being last.arrow_forward
- If a bacterial (E. coli) cell has 50,000 bp, how long will be a normal DNA replication?arrow_forwardIf the sequence 5′-AACGC-3′ were damaged by reactive oxygen species, what would be the most prevalent product, and what would be the result of replication? (Note: show both strands after replication)arrow_forwardexplain the term semiconservative replication?arrow_forward
- Does E. coli chromosomal replication always start at one particular site? What is called? If you were given the DNA sequence of E. coli chromosome, would you be able to identify where E. coli chromosomal replication starts? What is the end of E. coli chromosome replication?arrow_forwardWhy is a clamp loader necessary in replication?arrow_forwardA bacterium undergoes four rounds of replication. How many cells would result, and how many of those cells would still have part of an original DNA strand from the starting bacterium?arrow_forward
- The sequence below shows the ends of one strand of a linear chromosome, with slashes representing the middle part, which is not shown. During replication of this one strand, on which side of the slashes will Okazaki fragments be made in the newly synthesized strand? 5' AGCCGTACGGTTATCTCCTAG //// GGGCCTATTGTGACCAGTGAGTCG 3' a) Both sides b) Neither side c) The right side d) The left sidearrow_forwardWhy is the replication of DNA referred to as a semiconservative process? What is the experimental evidence for the semiconservative nature of the process? What experimental results would you expect if replication of DNA were a conservative process?arrow_forwardIs it biologically possible for DNA to undergo replication in vivo, without the lagging and the leading strands? In PCR, we also start with an antiparallel strand of DNA. Does this also mean that replication is semi-discontinuous in in vitro replication?arrow_forward
arrow_back_ios
SEE MORE QUESTIONS
arrow_forward_ios
Recommended textbooks for you
- Human Anatomy & Physiology (11th Edition)BiologyISBN:9780134580999Author:Elaine N. Marieb, Katja N. HoehnPublisher:PEARSONBiology 2eBiologyISBN:9781947172517Author:Matthew Douglas, Jung Choi, Mary Ann ClarkPublisher:OpenStaxAnatomy & PhysiologyBiologyISBN:9781259398629Author:McKinley, Michael P., O'loughlin, Valerie Dean, Bidle, Theresa StouterPublisher:Mcgraw Hill Education,
- Molecular Biology of the Cell (Sixth Edition)BiologyISBN:9780815344322Author:Bruce Alberts, Alexander D. Johnson, Julian Lewis, David Morgan, Martin Raff, Keith Roberts, Peter WalterPublisher:W. W. Norton & CompanyLaboratory Manual For Human Anatomy & PhysiologyBiologyISBN:9781260159363Author:Martin, Terry R., Prentice-craver, CynthiaPublisher:McGraw-Hill Publishing Co.Inquiry Into Life (16th Edition)BiologyISBN:9781260231700Author:Sylvia S. Mader, Michael WindelspechtPublisher:McGraw Hill Education
Human Anatomy & Physiology (11th Edition)
Biology
ISBN:9780134580999
Author:Elaine N. Marieb, Katja N. Hoehn
Publisher:PEARSON
Biology 2e
Biology
ISBN:9781947172517
Author:Matthew Douglas, Jung Choi, Mary Ann Clark
Publisher:OpenStax
Anatomy & Physiology
Biology
ISBN:9781259398629
Author:McKinley, Michael P., O'loughlin, Valerie Dean, Bidle, Theresa Stouter
Publisher:Mcgraw Hill Education,
Molecular Biology of the Cell (Sixth Edition)
Biology
ISBN:9780815344322
Author:Bruce Alberts, Alexander D. Johnson, Julian Lewis, David Morgan, Martin Raff, Keith Roberts, Peter Walter
Publisher:W. W. Norton & Company
Laboratory Manual For Human Anatomy & Physiology
Biology
ISBN:9781260159363
Author:Martin, Terry R., Prentice-craver, Cynthia
Publisher:McGraw-Hill Publishing Co.
Inquiry Into Life (16th Edition)
Biology
ISBN:9781260231700
Author:Sylvia S. Mader, Michael Windelspecht
Publisher:McGraw Hill Education
DNA vs RNA (Updated); Author: Amoeba Sisters;https://www.youtube.com/watch?v=JQByjprj_mA;License: Standard youtube license