BIOCHEMISTRY
9th Edition
ISBN: 2818440090622
Author: BERG
Publisher: MAC HIGHER
expand_more
expand_more
format_list_bulleted
Question
Chapter 5, Problem 12P
Interpretation Introduction
Interpretation:
The affect of altering temperature of hybridization on the PCR amplification is to be stated. The way by which the controlling of stringency of the hybridization helps an individual is to be stated.
Concept introduction:
DNA stands for deoxyribonucleic acid, is a biological macromolecule. DNA contains double helical strands along with the complementary base pairs. The four complementary bases of DNA are adenine (A), thymine (T), guanine (G) and cytosine (C).
The reaction that is used to make the duplicates of a particular DNA segment is known polymerase chain reaction (PCR).
Expert Solution & Answer
![Check Mark](/static/check-mark.png)
Want to see the full answer?
Check out a sample textbook solution![Blurred answer](/static/blurred-answer.jpg)
Students have asked these similar questions
This is DWA.
You hope to clone an extinct animal species by taking the easy route - using museum bones or
tissues. You extract the DNA and use PCR to amplify, then sequence all segments of the genome
You are unsuccessful. Later you discover that the museum specimens have been treated with
formaldehyde, which forms covalent bonds in DNA, where once there existed H-bonds.
What step in your PCR reaction would be inhibited?
g
-S
Knowing this, if a human was exposed to formaldehyde, what enzyme(s) of DNA
replication in vivo would be prevented from doing their job?
organisms ha
varieties. Through this process, several genetically (10)
been produced.
What I Can Do
Activity 7: MATCHY MATCHY
Direction: Match the purpose to the components found in the box below.
Antibiotic
Resistance Gene
Multiple Cloning Site
Promoter
DNA
Inserted Gene Sequence
Multiple Cloning Site
1. Allows the controlled expression of the desired gene in the
presence of an inducing agent (e.g., beta-galactosidase; heat
treatment (~65°"C)
2. DNA sequence or portion for the insertion of the desired gene.
This section may contain sequences that will be cut by
specific restriction endonucleases ( cuts within the molecule)
3. Successful insertion of a gene allows the expression of its
protein product. This usually provides a specific trait to the
"transformed" bacteria.
4. Provides a way to screen a population of bacteria for those
that took up the plasmid. For example, if an ampicillin
resistance gene is encoded in the plasmid, then only bacteria
10
t4
Pick a plasmid . What was its approximate transformation? Express it in # colonies per microgram of DNA transformed.
Assume the original DNA was about .001 ug/ul . Count how many colonies you got on one plate (or estimate that number) and figure out how much of the total solution you plated on that plate. Multiply by all the plates, if you plated all of it. OR, if you only plated some of it, figure out how many colonies you would have gotten had you plated all of it. Divide by the number of ug used.
Knowledge Booster
Similar questions
- Please answer this asap. Thanks, You have discovered a new plasmid RK21 in a unique bacterial community. As a first step towardunderstanding this plasmid, you digest the plasmid with three restriction enzymes: SspI, XhoI andSmaI. You run the digested plasmid DNA on an agarose gel, along with an uncut sample of theRK21 plasmid DNA as a control.Unfortunately you forget to load a DNA ladder, and obtain the following results. Assumecomplete digestion of all samples or all the digests worked completelyarrow_forwardplease help me with this question. As this is a non-directional cloning, recombinant plasmids can contain an insert ligated into the vector in two different orientations. Provide two diagrams to illustrate the two potential recombinant plasmids, with the inserts ligated in opposite orientations. Include all RE sites and distances between sites on the diagram.arrow_forwardCloned Libraries You are running a PCR to generate copies of a fragment of the cystic fibrosis (CF) gene. Beginning with two copies at the start, how much of an amplification of this fragment will be present after six cycles in the PCR machine?arrow_forward
- Describe your amplicon based on molecular size. Comparing the size of the genomic DNA Describe your amplicon based on molecular size. Comparing the size of the genomic DNA (as seen in Fig. 8.1) and the PCR products based on band position in the gel (as seen in Fig. 8.2).arrow_forwardPstl. EcoRI Origin of replication (ori) Ampicillin Tetracycline resistance resistance (Amp) (Tet") pBR322 (4,361 bp) BamHI Pvull Sall Recombinant Plasmid DNA Bacterial cell contains... No plasmid DNA pBR322 (no insert) Recombinant plasmid 00,000. Host DNA Transformation of E. coli cells +AMP plate pBR322 Figure 7-5 +TET plate Based on the recombinant plasmid growth pattern (bottom row of blue table), which of the depicted plasmid's restriction sites was used to prepare this sample? Explain how you can tell.arrow_forwardQuestion. What would the forward primer sequence look like if it were intended to bind the area of the DNA template?arrow_forward
- Primer designing: A single-stranded DNA sequence (963 nucleotides) that codes for a hypothetical protein are shown below (lower case shaded blue). 1. Design a pair of forward and reverse primers (~18 nucleotides long each) with EcoRI and BamHI added at 5' and 3' ends, respectively, for the amplification and cloning of this a plasmid with the same restriction sites. gene into GTATCGATAAGCTTGATATCGAATTCatggctaaaggcggagct cccgggttca aagtcgcaat acttggcgct gccggtggcattggccagccccttgcgatgttgatgaagatgaatcctctggtttctgttctacatctatatgatgtagtcaatgcccctggtgtcaccgctgatatta gccacatggacacgggtgctgtggtgcgtggattcttggggcagcagcagctggaggctgcgcttactggcatggatcttattatagtccctgcaggtgttcctcg aaaaccaggaatgacgagggatgatctgttcaaaataaacgcaggaattgtcaagactctgtgtgaagggattgcaaagtgttgtccaagagccattgtcaacctg atcagtaatcctgtgaactccaccgtgcccatcgcagctgaagttttcaagaaggctggaacttatgatccaaagcgacttctgggagttacaatgctcgacgtagt cagagccaatacctttgtggcagaagtattgggtcttgatcctcgggatgttgatgttccagttgttggcggtcatgetggtgtaaccatttgccccttctatctcagg…arrow_forwardExpand PCR? Describe the different Steps involved in this technique?arrow_forwardNeed help ASAP. How do you use FISH(fluorescence in situ hybridization) to detect gene rearrangement? Describe an example with the detail of the disease and the procedure.arrow_forward
- CRISPR? What are its applications in genetic engineering and gene therapy?arrow_forwardNeed help, please. 1) Which primer could be used as the forward primer, for synthesizing DNA from left to right in the above diagram? Enter the number of the primer here: 2) Which primer could be used as the reverse primer, for synthesizing DNA from right to left in the above diagram? Enter the number of the primer here: 3) Will these primers be part of the final PCR product? a.No, neither primer will be incorporated into the PCR product. b.The forward primer but not the reverse primer will be incorporated into the PCR product. c.The reverse primer but not the forward primer will be incorporated into the PCR product. d.Yes, both primers will be incorporated into the PCR product.arrow_forwardYou have another circular plasmid. Complete and effective digestion of this plasmid with a restriction enzyme yields three bands: 4kb, 2kb, and 1 kb. In comparing the band intensity on an ethidium bromide-stained gel, you notice that the 4 kb and the 2 kb bands have the exact same brightness. The 1 kb band is exactly one fourth as bright as each of these. (Assume there is uniform staining with ethidium bromide throughout the gel.) How many times did the enzyme cut the plasmid? What is the size of the plasmid? Justify your answers to a and b above using a clearly labeled diagram showing the relative location of the cut-sites on the plasmid.arrow_forward
arrow_back_ios
SEE MORE QUESTIONS
arrow_forward_ios
Recommended textbooks for you
- Human Heredity: Principles and Issues (MindTap Co...BiologyISBN:9781305251052Author:Michael CummingsPublisher:Cengage Learning
![Text book image](https://www.bartleby.com/isbn_cover_images/9781305251052/9781305251052_smallCoverImage.gif)
Human Heredity: Principles and Issues (MindTap Co...
Biology
ISBN:9781305251052
Author:Michael Cummings
Publisher:Cengage Learning