Concept explainers
Interpretation:
The reason corresponding to the fact that Taq polymerase is especially useful for PCR is to be stated.
Concept introduction:
The reaction that is used to make the duplicates of a particular DNA segment is known polymerase chain reaction (PCR). This reaction forms millions duplicate copies of a specific DNA segment.
The enzyme Taq polymerase is a synthetic enzyme. It is used to generate DNA strands at a very fast rate than other polymerases enzymes.
Answer to Problem 1P
The enzyme, Taq polymerase, is especially useful for PCR because this enzyme is stable in the high temperature condition also and does not get denatured.
Explanation of Solution
The polymerase chain reaction (PCR) possesses the high temperature due to which the natural or other polymerases enzymes get destroyed.
The enzyme, Taq polymerase, is a heat-stable enzyme. It is one of the types of DNA polymerase that can be stable at the high temperature also. This enzyme is stable in the condition of protein-denaturing as well.
Thus, Taq polymerase is especially useful for polymerase chain reaction which takes place at high temperature.
The enzyme, Taq polymerase, is especially useful for PCR because this enzyme is stable in the high temperature condition also and does not get denatured.
Want to see more full solutions like this?
Chapter 5 Solutions
Biochemistry 8e & Launchpad (twelve Month Access) (hardcover)
- Describe and contrast the common steps of DNA replication in vivo and the PCR reaction in vitro? In simple terms so, that I can understand. Thank youarrow_forwardTransformation and sequence validation of the clonesarrow_forwardDNA polymerase requires both a template, to be copied, and a primer, which provides a 3′ hydroxyl from which polymerase can extend. Yet, this molecule supports DNA polymerase activity. Explain. pTGACACAGGTTTAGCCCATCGATGGG -OHarrow_forward
- helping tags: biochemistry, PCR, polymerase chain reaction, PCR cocktail preparation Will upvote, just please help me solve the answers for the mastermix. Please show solutions. Thanks.arrow_forwardCloned Libraries You are running a PCR to generate copies of a fragment of the cystic fibrosis (CF) gene. Beginning with two copies at the start, how much of an amplification of this fragment will be present after six cycles in the PCR machine?arrow_forwardGenetically Modified Foods The creation of transgenic crop plants using recombinant DNA methods involves the transfer of just one gene or a small number of genes to the plants, in contrast to classical breeding methods in which hundreds or even thousands of genes are transferred at once. Explain why this is true. If fewer genes are transferred during the creation of transgenic crops, why are some people afraid that they are dangerous?arrow_forward
- What would you need to do to preform a successful PCR but only had thermolabile DNA polymerase? Can be kept relativity simplearrow_forwardPCR is quick, efficient and easy to perform. However, there are some situations when cell-based cloning is preferred over PCR to amplify a DNA sequence. Mention two of them.arrow_forwardPlasmid Mapping (what is it? why is it important?).arrow_forward
- A primer of some sort must be synthesized so that polymerization can commence under the direction of DNA polymerase III. Surprisingly, RNA, not DNA, serves as the primer. Give your on this ?arrow_forwardUV-induced DNA Damage and Repair by Photoreactivation Experiment Can you help me regarding on how to compute for the % survival rate and % mortality rate. (You can give random examples for the number of irradiated colonies & number of photoreactivated colonies, I just want to see how it is computed). Thank youarrow_forwardMULTIPLE CHOICE 1. What enzyme that function for cutting a DNA? A. Nuclease B. Ligase C. Primase D. Isomerase 2. Which of the following does not involved in the proofreading and repair of DNA? A. Isomerase B. Ligase C. DNA Polymerase I D. Nucleasearrow_forward
- Biology 2eBiologyISBN:9781947172517Author:Matthew Douglas, Jung Choi, Mary Ann ClarkPublisher:OpenStaxHuman Heredity: Principles and Issues (MindTap Co...BiologyISBN:9781305251052Author:Michael CummingsPublisher:Cengage Learning