Microbiology With Diseases.. -Masteringmic.
5th Edition
ISBN: 9780134298719
Author: BAUMAN
Publisher: PEARSON
expand_more
expand_more
format_list_bulleted
Concept explainers
Videos
Question
Chapter 7, Problem 15CT
Summary Introduction
To determine:
The amino acid sequence of the product formed by the DNA molecule with
Concept introduction:
The unit of genetic code, which has three nucleotides that code for amino acids, is called codon. The mRNA (messenger ribonucleic acid) got attached to the ribosomal complex in the cytoplasm. The transfer RNA conveys amino acids to the ribosomal complex where the pairing of an anticodon of tRNA (transfer ribonucleic acid) takes place with a complementary codon of the messenger RNA.
Again, new amino acid is carried by tRNA, which again binds to the complementary codon of mRNA. In this way, amino acids get linked to each other, forming the long chain of the polypeptides.
Expert Solution & Answer
Want to see the full answer?
Check out a sample textbook solution
Students have asked these similar questions
If a scientist synthesizes a DNA molecule with a nucleotide base sequence to TACGGGGGAGGGGGAGGGGGA transcription and translation what would be the amino acid sequence of the product?
Suppose you are provided with a sequence of nucleotides. How would you determine if the sequence is of mRNA, tRNA, or DNA molecules?
The transcription enzyme that catalyzes a strand of RNA from a DNA template is called what?
Chapter 7 Solutions
Microbiology With Diseases.. -Masteringmic.
Ch. 7 - Which of the following is most likely the number...Ch. 7 - Which of the following is a true statement...Ch. 7 - Prob. 3MCCh. 7 - Prob. 4MCCh. 7 - Prob. 5MCCh. 7 - Prob. 6MCCh. 7 - Prob. 7MCCh. 7 - Prob. 8MCCh. 7 - Prob. 9MCCh. 7 - Prob. 10MC
Ch. 7 - Which of the following is not a mechanism of...Ch. 7 - Prob. 12MCCh. 7 - Prob. 13MCCh. 7 - Which of the following are called jumping genes?...Ch. 7 - Prob. 15MCCh. 7 - Prob. 16MCCh. 7 - Prob. 17MCCh. 7 - Prob. 18MCCh. 7 - Prob. 19MCCh. 7 - Prob. 20MCCh. 7 - Prob. 21MCCh. 7 - Prob. 22MCCh. 7 - Prob. 23MCCh. 7 - Prob. 24MCCh. 7 - The trp operon is repressible. This means it is...Ch. 7 - The three steps in RNA transcription are...Ch. 7 - Prob. 2FIBCh. 7 - Prob. 3FIBCh. 7 - Prob. 4FIBCh. 7 - An operon consists of ____________,...Ch. 7 - Prob. 6FIBCh. 7 - A daughter DNA molecule is composed of one...Ch. 7 - Prob. 8FIBCh. 7 - Prob. 9FIBCh. 7 - ____________ is a recombination event that occurs...Ch. 7 - Prob. 11FIBCh. 7 - Prob. 12FIBCh. 7 - Prob. 1SACh. 7 - Prob. 2SACh. 7 - Prob. 3SACh. 7 - Polypeptide synthesis requires large amounts of...Ch. 7 - Prob. 5SACh. 7 - Prob. 6SACh. 7 - Prob. 7SACh. 7 - Prob. 8SACh. 7 - Describe how DNA is packaged in both prokaryotes...Ch. 7 - Prob. 10SACh. 7 - Prob. 11SACh. 7 - Prob. 12SACh. 7 - On the figure below, label DNA polymerase I, DNA...Ch. 7 - Prob. 2VICh. 7 - Prob. 3VICh. 7 - If molecules of mRNA have the following nucleotide...Ch. 7 - A scientist uses a molecule of DNA composed of...Ch. 7 - Prob. 3CTCh. 7 - Prob. 4CTCh. 7 - Prob. 5CTCh. 7 - Suppose that the E. coli gene for the lac operon...Ch. 7 - Prob. 7CTCh. 7 - Prob. 8CTCh. 7 - Prob. 9CTCh. 7 - How can knowledge of nucleotide analogs be useful...Ch. 7 - The endosymbiotic theory states that mitochondria...Ch. 7 - Prob. 12CTCh. 7 - Prob. 13CTCh. 7 - Prob. 14CTCh. 7 - Prob. 15CTCh. 7 - What DNA nucleotide triplet codes for codon UGU?...Ch. 7 - Prob. 17CTCh. 7 - Prob. 1CMCh. 7 - DNA replication requires a large amount of energy,...Ch. 7 - In bacteria, polypeptide translation can begin...Ch. 7 - Prob. 3TMWCh. 7 - Prob. 4TMWCh. 7 - Clinical Case Study Deadly Horizontal Gene...Ch. 7 - Emerging Disease Case Study Vibrio Vulnificus...
Knowledge Booster
Learn more about
Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.Similar questions
- A DNA strand with the sequence 3’ AACGTAACG 5’ is transcribed. What is the sequence of the mRNA molecule? 5’ AACGTAACG 3’ 5’ UUGCAUUGC 3’ 5’ TTGCATTGC 3’ 5’ UUGCAUUGC 3’arrow_forwardWhy is a mutation of a base in a DNA sequence much more serious than a mutation in a transcribed mRNA sequence?arrow_forwardWhat is the sequence of the DNA template strand from which each of the following mRNA strands was synthesized? a. 5 '–UGGGGCAUU–3 ' c. 5 '–CCGACGAUG–3 'b. 5 '–GUACCU–3 ' d. 5 '–GUAGUCACG–3 'arrow_forward
- Refer to the double stranded DNA molecule with the sequence below to answer the following questions: 5’ATATGGGTCTCGATAGGGCTGTTTTCTCCGGC 3’ 3’TATACCCAGAGCTATCCCGACAAAAGAGGCCG 5’ Which strand functions as the transcription template, the top one or the bottom one? Explain your reasoning. What is the mRNA transcript and polypeptide from this strand? In the space below, copy the DNA strand that is transcribed, and write the mRNA transcript and polypeptide chain below it. Align the mRNA and polypeptide so that it is clear which DNA bases they came from. DNA strand: mRNA: amino acid sequence:arrow_forwardWhat would be the mRNA strand if the DNA strand reads: T A C C G A G T C A C G?arrow_forwardwhat is the ONLY reason a cell would need to make copies of DNA?arrow_forward
- Why is DNA and not any other macromolecule represents the genetic code?arrow_forwardA scientist sequencing mRNA identifies the following strand: AUAUAUACUAUCAUGUAAUAUGUGUCGUAACAGCCGAUGACCCGWhat is the sequence of the amino acid chain this mRNA makes when it is translated?arrow_forwardA scientist while sequencing mrna identifies the following strand cugucaguacuaagagucgaugacgcgggguuuac what is sequence of amino acid chain this mRNA makes when it is translated?arrow_forward
- Transcribe the following strand into Mrna, then translate it into amino acidsarrow_forwardIn which of the following would you find the start codon sequence of a gene? mRNA DNA and mRNA mRNA and protein DNA, mRNA and protein Proteinarrow_forwardIf the sequence of an mRNA is GAGUUCACAGUAGGC, the sequence of the template strand of the corresponding gene is... which of the following answers? a. CTCAAGTGTCATCCG b. GCCTACTGTGAACTC c. 3' GAGTTCACAGTAGGC 5' d. GAGTTCACAGTAGGC e. none of the abovearrow_forward
arrow_back_ios
SEE MORE QUESTIONS
arrow_forward_ios
Recommended textbooks for you
Human Biology (MindTap Course List)BiologyISBN:9781305112100Author:Cecie Starr, Beverly McMillanPublisher:Cengage Learning
Human Heredity: Principles and Issues (MindTap Co...BiologyISBN:9781305251052Author:Michael CummingsPublisher:Cengage Learning
Human Biology (MindTap Course List)
Biology
ISBN:9781305112100
Author:Cecie Starr, Beverly McMillan
Publisher:Cengage Learning
Human Heredity: Principles and Issues (MindTap Co...
Biology
ISBN:9781305251052
Author:Michael Cummings
Publisher:Cengage Learning
QCE Biology: Introduction to Gene Expression; Author: Atomi;https://www.youtube.com/watch?v=a7hydUtCIJk;License: Standard YouTube License, CC-BY