Microbiology with Diseases by Body System (5th Edition)
5th Edition
ISBN: 9780134477206
Author: Robert W. Bauman Ph.D.
Publisher: PEARSON
expand_more
expand_more
format_list_bulleted
Concept explainers
Textbook Question
Chapter 7, Problem 1CT
If molecules of mRNA have the following
- a. AUGGGGAUACGCUACCCC
- b. CCGUACAUGCUAAUCCCU
- c. CCGAUGUMCCUCGAUCC
- d. AUGCGGUCAGCCCCGUGA
Expert Solution & Answer
Want to see the full answer?
Check out a sample textbook solutionStudents have asked these similar questions
A single template strand of a DNA molecule is represented by
3’atgtaccatgcgcaaatttaaaggccc5’.
a) Imagine that AAG is an INTRON in the original DNA template strand above. Write the mature mRNA strand after the three modifications?
b) Write the amino acid sequence of your mature mRNA.
c) List the molecules involved in translation and briefly describe their function.
3’ G G A U A C G U C A C C G G U A U A A G G U U U C G U A U C G 5’
If the RNA synthesized above is a functional mRNA and all the nucleotides belong to an exon,
a. how many codons are present in this mRNA?
b. how many codons actually code for a protein in this mRNA?
c. what stop codon is present in this mRNA?
Considering the given sequence of nucleotides in an mRNA molecule, (a) what is the sequence of the DNA template strand from which the RNA was synthesized? (b) What peptide is synthesized by this mRNA sequence? 5' GAG CCC GUA UAC GCC ACG 3'
Chapter 7 Solutions
Microbiology with Diseases by Body System (5th Edition)
Ch. 7 - DNA replication requires a large amount of energy,...Ch. 7 - Vibrio vulnificus Infection Greg enjoyed Floridas...Ch. 7 - Prob. 2TMWCh. 7 - Prob. 3TMWCh. 7 - Why is the genetic ancestry of microbes much more...Ch. 7 - Prob. 1CCSCh. 7 - Which of the following is most likely the number...Ch. 7 - Which of the following is a true statement...Ch. 7 - A plasmid is ___________. a. a molecule of RNA...Ch. 7 - Prob. 4MC
Ch. 7 - Prob. 5MCCh. 7 - Which of the following molecules functions as a...Ch. 7 - Prob. 7MCCh. 7 - Prob. 8MCCh. 7 - The Ames test ___________. a. uses auxotrophs and...Ch. 7 - Which of the following methods of DNA repair...Ch. 7 - Prob. 11MCCh. 7 - Prob. 12MCCh. 7 - Which of the following statements is true? a....Ch. 7 - Prob. 14MCCh. 7 - Although two cells are totally unrelated, one cell...Ch. 7 - Prob. 16MCCh. 7 - Prob. 17MCCh. 7 - Prob. 18MCCh. 7 - Prob. 19MCCh. 7 - Prob. 20MCCh. 7 - Prob. 21MCCh. 7 - Prob. 22MCCh. 7 - Prob. 23MCCh. 7 - Before mutations can affect a population...Ch. 7 - Prob. 25MCCh. 7 - Fill in the Blanks 1. The three steps in RNA...Ch. 7 - Fill in the Blanks 2. A triplet of mRNA...Ch. 7 - Fill in the Blanks 3. Three effects of point...Ch. 7 - Fill in the Blanks 4. Insertions and deletions in...Ch. 7 - Fill in the Blanks 5. An operon consists of...Ch. 7 - Prob. 6FIBCh. 7 - Prob. 7FIBCh. 7 - Fill in the Blanks 8. A gene for antibiotic...Ch. 7 - Fill in the Blanks 9. ______ are nucleotide...Ch. 7 - Fill in the Blanks 10. ____________ is a...Ch. 7 - Fill in the Blanks 11.________ RNA carries amino...Ch. 7 - Fill in the Blanks 12. ______ RNA and ______ RNA...Ch. 7 - How does the genotype of a bacterium determine its...Ch. 7 - List several ways in which eukaryotic messenger...Ch. 7 - Compare and contrast intrans and exons.Ch. 7 - Polypeptide synthesis requires large amounts of...Ch. 7 - Describe the operon model of gene regulation.Ch. 7 - Prob. 6SACh. 7 - Prob. 7SACh. 7 - Describe the formation and function of mRNA, rRNA,...Ch. 7 - Prob. 9SACh. 7 - Explain the central dogma of genetics.Ch. 7 - Compare and contrast the processes of...Ch. 7 - Fill in the following table:Ch. 7 - On the figure below, label DNA polymerase I, DNA...Ch. 7 - Prob. 2VICh. 7 - The drugs ddC and AZT are used to treat AIDS....Ch. 7 - If molecules of mRNA have the following nucleotide...Ch. 7 - A scientist uses a molecule of DNA composed of...Ch. 7 - Explain why an insertion of three nucleotides is...Ch. 7 - How could scientists use siRNA to turn off a...Ch. 7 - Prob. 5CTCh. 7 - Prob. 6CTCh. 7 - Prob. 7CTCh. 7 - Prob. 8CTCh. 7 - Corynebacterium diphtheriae, the causative agent...Ch. 7 - Prob. 10CTCh. 7 - The endosymbiotic theory states that mitochondria...Ch. 7 - Hydrogen bonds between complementary nucleotides...Ch. 7 - On average, RNA polymerase makes one error for...Ch. 7 - We have seen that wobble makes the genetic code...Ch. 7 - If a scientist synthesizes a DNA molecule with the...Ch. 7 - What DNA nucleotide triplet codes for codon UGU?...Ch. 7 - Suppose you want to insert into your dog a gene...Ch. 7 - Using the following terms, fill in the following...
Knowledge Booster
Learn more about
Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.Similar questions
- A segment of DNA has the followimg sequence of bases.. 5'-ATGCAATGATATTGAAGCTTA-3' a) What sequence of bases would appear in mRNA transcribed from this segment? b) Assume the first base in this mRNA is the beginning of a codon. What order of amino acid would be translated into a polypeptide synthesized along this segment? c) Give anticodons for each tRNA associated with the translation in part (b)arrow_forwardBelow is the 5’–3’ strand of a double-stranded DNA molecule with the following nucleotide sequences:5’ C C T A T G C A G T G G C C A T A T T C C A A A G C A T A G C 3’ 1. If the RNA synthesized above (item #1) is a functional mRNA and all the nucleotides belong to an exon,a. how many codons are present in this mRNA?b. how many codons actually code for proteins in this mRNA?c. what stop codon is present in this mRNA?arrow_forwardA particular triplet of bases in the anticodon strand of the tRNA is 5' - AGU - 3'. A. The corresponding codon for the mRNA is _________ (write 5’ --> 3). B. If this codon is translated, the codon specifies the addition of which amino acid? _______________________arrow_forward
- The AUC and AUA codons in mRNA both specify isoleucine. What feature of the genetic code explains this? a. complementarity b. nonsense codons c. universality d. degeneracyarrow_forwardTranslation of the dna sequence AAGCTGGGA would result in: A) a DNA strand with the base sequence TTCGACCCT B) an mRNA strand with the sequence TTCGACCCT C) a sequence of three amino acids linked by peptide bonds D) an mRNA strand with the sequence UUGCACCCUarrow_forwardOnce translated into proteins: (a) How many nucleotides are there? (b) How many codons are there? (c) How many amino acids?arrow_forward
- The codon UUU in an mRNA molecule which results in phenylalanine being inserted as the protein is made. Which will be a characteristic of this codon? a. The tRNA molecule that binds to the UUU codon must have an AAA anticodon. Nde ba e2? b. UUU could code for both phenylalanine and alanine during translation. c. The aminoacyl-tRNA synthetase for phenylalanine binds only the UUU codon. d. UUU is probably only one of several codons that code for phenylalanine.arrow_forwardAn mRNA has the following sequence: 5′–CAGGCGGCGAUGGACAAUAAAGCGGGCCUGUAAGC–3′ Identify the start codon, and determine the complete amino acid sequence that will be translated from this mRNA.arrow_forwardGiven the following non-coding strand of DNA nucleotides:G T T C C C T T T G G A A C C T G G Write the nucleotide sequence of the coding strand of DNA:b. Write the nucleotide sequence of mRNA resulting from transcription:c. Using the genetic code, write the amino acid sequence translated:arrow_forward
- Write a mRNA sequence for the below nucleotide sequences ATTACACACAGCGCGTATACGCGCGCGGGCTATAarrow_forwardTemplate strand of DNA is: 3’ TACATAACCGGGCCCATATCGGCCATTTGC5’. 2a). Following transcription, what is the total number of codons in the mRNA transcript? 2 b). Where is the start codon located in this mRNA transcript? 2c). Following translation of this mRNA transcript, how many amino acids will the proteincontain and identify the amino acids sequence of this gene from a genetic code table*.*Note= using a genetic code tablearrow_forwardA single template strand of a DNA molecule is represented by 3’atgtaccatgcgcaaatttaaaggccc5’. a) Using the same strand above as a template, write the pre-mRNA transcript. b) List the molecules that must be present for DNA to be transcribed. Briefly describe their function. c) What are three modifications that happen to pre-mRNA before it becomes mature mRNAarrow_forward
arrow_back_ios
SEE MORE QUESTIONS
arrow_forward_ios
Recommended textbooks for you
What is Genomics - Full Length; Author: Genome BC;https://www.youtube.com/watch?v=mmgIClg0Y1k;License: Standard youtube license