bartleby

Concept explainers

bartleby

Videos

Question
Book Icon
Chapter 7, Problem 23MC
Summary Introduction

Introduction:

The generation of DNA off springs from the parental DNA was termed as DNA replication. DNA replication was carried out with the help of enzymes. Several enzymes are involved in the replication, such as helicase, primase, DNA polymerase, ligase, telomerase, nuclease, and so on. Each one possesses a separate role in the whole DNA replication process.

Blurred answer
Students have asked these similar questions
Treating a cell with a drug to stop tRNA from doing its job would mean what? A. that ribosomes would fall apart B. that sugars woulf not be added to proteins C. that nothing would be available to translate D. that amino acids would not be brought to the growing protein.
A single template strand of a DNA molecule is represented by  3’atgtaccatgcgcaaatttaaaggccc5’. a) Imagine that AAG is an INTRON in the original DNA template strand above.  Write the mature mRNA strand after the three modifications?   b) Write the amino acid sequence of your mature mRNA. c) List the molecules involved in translation and briefly describe their function.
Use your genetic code (codon) table to answer the next two questions: What type of mutation would result if the sequence of a gene were altered so that the sequence of the mRNA was changed from: AUGCCGUGCAGUAAC    to        AUGCCAUGCAGUAAC A) a silent mutation B) a nonsense mutation C) a frame-shift mutation D) a missense mutation  E) a base insertion mutation

Chapter 7 Solutions

MasteringMicrobiology with Pearson Etext - Valuepack Access Card - for Microbiology with Diseases by Body System

Ch. 7 - Prob. 5MCCh. 7 - Which of the following molecules functions as a...Ch. 7 - Prob. 7MCCh. 7 - Prob. 8MCCh. 7 - The Ames test ___________. a. uses auxotrophs and...Ch. 7 - Which of the following methods of DNA repair...Ch. 7 - Prob. 11MCCh. 7 - Prob. 12MCCh. 7 - Which of the following statements is true? a....Ch. 7 - Prob. 14MCCh. 7 - Although two cells are totally unrelated, one cell...Ch. 7 - Prob. 16MCCh. 7 - Prob. 17MCCh. 7 - Prob. 18MCCh. 7 - Prob. 19MCCh. 7 - Prob. 20MCCh. 7 - Prob. 21MCCh. 7 - Prob. 22MCCh. 7 - Prob. 23MCCh. 7 - Before mutations can affect a population...Ch. 7 - Prob. 25MCCh. 7 - Fill in the Blanks 1. The three steps in RNA...Ch. 7 - Fill in the Blanks 2. A triplet of mRNA...Ch. 7 - Fill in the Blanks 3. Three effects of point...Ch. 7 - Fill in the Blanks 4. Insertions and deletions in...Ch. 7 - Fill in the Blanks 5. An operon consists of...Ch. 7 - Prob. 6FIBCh. 7 - Prob. 7FIBCh. 7 - Fill in the Blanks 8. A gene for antibiotic...Ch. 7 - Fill in the Blanks 9. ______ are nucleotide...Ch. 7 - Fill in the Blanks 10. ____________ is a...Ch. 7 - Fill in the Blanks 11.________ RNA carries amino...Ch. 7 - Fill in the Blanks 12. ______ RNA and ______ RNA...Ch. 7 - How does the genotype of a bacterium determine its...Ch. 7 - List several ways in which eukaryotic messenger...Ch. 7 - Compare and contrast intrans and exons.Ch. 7 - Polypeptide synthesis requires large amounts of...Ch. 7 - Describe the operon model of gene regulation.Ch. 7 - Prob. 6SACh. 7 - Prob. 7SACh. 7 - Describe the formation and function of mRNA, rRNA,...Ch. 7 - Prob. 9SACh. 7 - Explain the central dogma of genetics.Ch. 7 - Compare and contrast the processes of...Ch. 7 - Fill in the following table:Ch. 7 - On the figure below, label DNA polymerase I, DNA...Ch. 7 - Prob. 2VICh. 7 - The drugs ddC and AZT are used to treat AIDS....Ch. 7 - Prob. 1CTCh. 7 - A scientist uses a molecule of DNA composed of...Ch. 7 - Explain why an insertion of three nucleotides is...Ch. 7 - How could scientists use siRNA to turn off a...Ch. 7 - Prob. 5CTCh. 7 - Prob. 6CTCh. 7 - Prob. 7CTCh. 7 - Prob. 8CTCh. 7 - Corynebacterium diphtheriae, the causative agent...Ch. 7 - Prob. 10CTCh. 7 - The endosymbiotic theory states that mitochondria...Ch. 7 - Hydrogen bonds between complementary nucleotides...Ch. 7 - On average, RNA polymerase makes one error for...Ch. 7 - We have seen that wobble makes the genetic code...Ch. 7 - If a scientist synthesizes a DNA molecule with the...Ch. 7 - What DNA nucleotide triplet codes for codon UGU?...Ch. 7 - Suppose you want to insert into your dog a gene...Ch. 7 - Using the following terms, fill in the following...
Knowledge Booster
Background pattern image
Biology
Learn more about
Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.
Similar questions
SEE MORE QUESTIONS
Recommended textbooks for you
Text book image
BIOLOGY:CONCEPTS+APPL.(LOOSELEAF)
Biology
ISBN:9781305967359
Author:STARR
Publisher:CENGAGE L
Text book image
Concepts of Biology
Biology
ISBN:9781938168116
Author:Samantha Fowler, Rebecca Roush, James Wise
Publisher:OpenStax College
QCE Biology: Introduction to Gene Expression; Author: Atomi;https://www.youtube.com/watch?v=a7hydUtCIJk;License: Standard YouTube License, CC-BY