Modified Mastering Microbiology with Pearson eText -- Standalone Access Card -- for Microbiology with Diseases by Body System (5th Edition)
5th Edition
ISBN: 9780134607900
Author: Robert W. Bauman Ph.D.
Publisher: PEARSON
expand_more
expand_more
format_list_bulleted
Concept explainers
Question
Chapter 7, Problem 23MC
Summary Introduction
Introduction:
The generation of DNA off springs from the parental DNA was termed as DNA replication. DNA replication was carried out with the help of enzymes. Several enzymes are involved in the replication, such as helicase, primase, DNA polymerase, ligase, telomerase, nuclease, and so on. Each one possesses a separate role in the whole DNA replication process.
Expert Solution & Answer
Want to see the full answer?
Check out a sample textbook solutionStudents have asked these similar questions
Treating a cell with a drug to stop tRNA from doing its job would mean what?
A. that ribosomes would fall apart
B. that sugars woulf not be added to proteins
C. that nothing would be available to translate
D. that amino acids would not be brought to the growing protein.
A single template strand of a DNA molecule is represented by
3’atgtaccatgcgcaaatttaaaggccc5’.
a) Imagine that AAG is an INTRON in the original DNA template strand above. Write the mature mRNA strand after the three modifications?
b) Write the amino acid sequence of your mature mRNA.
c) List the molecules involved in translation and briefly describe their function.
Use your genetic code (codon) table to answer the next two questions:
What type of mutation would result if the sequence of a gene were altered so that the sequence of the mRNA was changed from:
AUGCCGUGCAGUAAC to AUGCCAUGCAGUAAC
A) a silent mutation
B) a nonsense mutation
C) a frame-shift mutation
D) a missense mutation
E) a base insertion mutation
Chapter 7 Solutions
Modified Mastering Microbiology with Pearson eText -- Standalone Access Card -- for Microbiology with Diseases by Body System (5th Edition)
Ch. 7 - DNA replication requires a large amount of energy,...Ch. 7 - Vibrio vulnificus Infection Greg enjoyed Floridas...Ch. 7 - Prob. 2TMWCh. 7 - Prob. 3TMWCh. 7 - Why is the genetic ancestry of microbes much more...Ch. 7 - Prob. 1CCSCh. 7 - Which of the following is most likely the number...Ch. 7 - Which of the following is a true statement...Ch. 7 - A plasmid is ___________. a. a molecule of RNA...Ch. 7 - Prob. 4MC
Ch. 7 - Prob. 5MCCh. 7 - Which of the following molecules functions as a...Ch. 7 - Prob. 7MCCh. 7 - Prob. 8MCCh. 7 - The Ames test ___________. a. uses auxotrophs and...Ch. 7 - Which of the following methods of DNA repair...Ch. 7 - Prob. 11MCCh. 7 - Prob. 12MCCh. 7 - Which of the following statements is true? a....Ch. 7 - Prob. 14MCCh. 7 - Although two cells are totally unrelated, one cell...Ch. 7 - Prob. 16MCCh. 7 - Prob. 17MCCh. 7 - Prob. 18MCCh. 7 - Prob. 19MCCh. 7 - Prob. 20MCCh. 7 - Prob. 21MCCh. 7 - Prob. 22MCCh. 7 - Prob. 23MCCh. 7 - Before mutations can affect a population...Ch. 7 - Prob. 25MCCh. 7 - Fill in the Blanks 1. The three steps in RNA...Ch. 7 - Fill in the Blanks 2. A triplet of mRNA...Ch. 7 - Fill in the Blanks 3. Three effects of point...Ch. 7 - Fill in the Blanks 4. Insertions and deletions in...Ch. 7 - Fill in the Blanks 5. An operon consists of...Ch. 7 - Prob. 6FIBCh. 7 - Prob. 7FIBCh. 7 - Fill in the Blanks 8. A gene for antibiotic...Ch. 7 - Fill in the Blanks 9. ______ are nucleotide...Ch. 7 - Fill in the Blanks 10. ____________ is a...Ch. 7 - Fill in the Blanks 11.________ RNA carries amino...Ch. 7 - Fill in the Blanks 12. ______ RNA and ______ RNA...Ch. 7 - How does the genotype of a bacterium determine its...Ch. 7 - List several ways in which eukaryotic messenger...Ch. 7 - Compare and contrast intrans and exons.Ch. 7 - Polypeptide synthesis requires large amounts of...Ch. 7 - Describe the operon model of gene regulation.Ch. 7 - Prob. 6SACh. 7 - Prob. 7SACh. 7 - Describe the formation and function of mRNA, rRNA,...Ch. 7 - Prob. 9SACh. 7 - Explain the central dogma of genetics.Ch. 7 - Compare and contrast the processes of...Ch. 7 - Fill in the following table:Ch. 7 - On the figure below, label DNA polymerase I, DNA...Ch. 7 - Prob. 2VICh. 7 - The drugs ddC and AZT are used to treat AIDS....Ch. 7 - If molecules of mRNA have the following nucleotide...Ch. 7 - A scientist uses a molecule of DNA composed of...Ch. 7 - Explain why an insertion of three nucleotides is...Ch. 7 - How could scientists use siRNA to turn off a...Ch. 7 - Prob. 5CTCh. 7 - Prob. 6CTCh. 7 - Prob. 7CTCh. 7 - Prob. 8CTCh. 7 - Corynebacterium diphtheriae, the causative agent...Ch. 7 - Prob. 10CTCh. 7 - The endosymbiotic theory states that mitochondria...Ch. 7 - Hydrogen bonds between complementary nucleotides...Ch. 7 - On average, RNA polymerase makes one error for...Ch. 7 - We have seen that wobble makes the genetic code...Ch. 7 - If a scientist synthesizes a DNA molecule with the...Ch. 7 - What DNA nucleotide triplet codes for codon UGU?...Ch. 7 - Suppose you want to insert into your dog a gene...Ch. 7 - Using the following terms, fill in the following...
Knowledge Booster
Learn more about
Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.Similar questions
- Transcription is similar to DNA replication because both processes_______ . a. use the same enzyme b. copy both strands c. require the same nucleotides d. proceed in the 5′ to 3′ directionarrow_forwardThe role of p53 in normal cells is toa. create cancer-blocking mutations.b. trigger unrestrained cell division.c. detect damaged DNA.d. splice exons together in the correct sequence.arrow_forwardWhich is true about eukaryotic cDNA? Choose all that apply a. it is single stranded b. it is made up of only introns c. it is constructed from mRNA that is reverse transcribed d.arrow_forward
- Translation of the dna sequence AAGCTGGGA would result in: A) a DNA strand with the base sequence TTCGACCCT B) an mRNA strand with the sequence TTCGACCCT C) a sequence of three amino acids linked by peptide bonds D) an mRNA strand with the sequence UUGCACCCUarrow_forwardThe Kozak rules determine a. the choice of the start codon in complex eukaryotes. b. the choice of the start codon in bacteria. c. the site in the mRNA where translation ends. d. how fast the mRNA is translated.arrow_forwardWhich statement is true of the translocation phase of elongation during protein synthesis? a. The empty tRNA moves to the A site of the ribosomal complex. b. The empty tRNA moves to the T site of the ribosomal complex. c. The dipeptide moves from the A site to the P site of the ribosomal complex. d. The dipeptide moves from the P site to the A site of the ribosomal complex.arrow_forward
- Which of the following best describes tRNA? a. Provides the instructions for the amino acid sequence of a polypeptide b. Complexes with ribosomal proteins to form ribosomes c. Used for eukaryotic RNA processing d. Transports amino acids to ribosomes during translationarrow_forwardGiven the following DNA sequence: ATCGGATCCGGTTAACTATTTAAAGCA a. predict the compliment strand of dna (coding strand) b. predict the transcribed product of the coding strand (mRNA transcript) c. given the genetic code table, predict the amino acid sequence of the transcript d. predict the amino acid sequence if the A underlined became deletedarrow_forwardRibosomal RNA ____________________. a. Carries amino acids to the ribosome b. Carries information from the DNA to the ribosome c. Helps make up the ribosome d. Carries oxygen to cellsarrow_forward
- Messenger RNA ____________________. a. Carries amino acids to the ribosome b. Carries information from the DNA to the ribosome c. Helps make up the ribosome d. Carries oxygen to cellsarrow_forwardIf a eukaryotic mRNA has failed to have a cap attached to its 5' end, what would the negative consequence(s) be? I chose b and got this questions wrong, why is this wrong? a. The mRNA would not properly exit the nucleus. b. The mRNA would not properly bind to a ribosome. c. The mRNA would not receive a poly A tail. d. The mRNA would not use the correct start codon. e. Both a and b are correct.arrow_forwardSpecific amino acids attached to molecules of tRNA, while antocodons align with codons of mRNA describes, in part a.replication b.transcription c.translation d.recombinant DNA formation e.cellular activationarrow_forward
arrow_back_ios
SEE MORE QUESTIONS
arrow_forward_ios
Recommended textbooks for you
- Concepts of BiologyBiologyISBN:9781938168116Author:Samantha Fowler, Rebecca Roush, James WisePublisher:OpenStax College
Concepts of Biology
Biology
ISBN:9781938168116
Author:Samantha Fowler, Rebecca Roush, James Wise
Publisher:OpenStax College
QCE Biology: Introduction to Gene Expression; Author: Atomi;https://www.youtube.com/watch?v=a7hydUtCIJk;License: Standard YouTube License, CC-BY