Concept explainers
To analyze:
In laboratory, the following dideoxy DNA sequencing gel is produced.
The double-stranded DNA sequence of this molecules to be determined.
The polarity of each strand is to be labeled.
Introduction:
DNA sequencing is the determination of a sequence of
Sanger sequencing is a method of sequencing a region of DNA that is up to
Sanger sequencing was first developed by Fred Sanger and his colleagues in
This process involved the formation of many copies of the template DNA strand.
Dideoxynucleotides inhibit the chain elongation process of DNA polymerases. They are also abbreviated as
The principle of Sanger sequencing is that sufficient time and material can produce at least one DNA sequence of every possible length with a tagged nucleotide at the end.
The tagged nucleotides get terminated because ddNTPs lack
Trending nowThis is a popular solution!
Chapter 7 Solutions
Study Guide And Solutions Manual For Genetic Analysis: An Integrated Approach
- Chemical analysis shows that a nucleic acid sample contains A, U, C, and G. Is this DNA or RNA? Why?arrow_forwardTranscribe and translate the following DNA sequence (nontemplate strand): 5’-ATGGCCGGTTATTAAGCA-3’arrow_forwardDuring agarose gel electrophoresis, why does DNA move through the gel when electric current is applied? because DNA is negatively charged because a charged chemical from the loading buffer is bound to the DNA because DNA is positively charged because DNA absorbs electricityarrow_forward
- Sanger DNA sequencing/ dideoxy sequencing was used as shown in the diagram below. The arrow indicates the direction for migration of the bands in the gel. What are the first 3 letters of this DNA sequence?arrow_forwardWhat does the 260 nm light detect when measuring the purity of a DNA sample? Please select the single answer that is most correct. DNA RNA Proteins The sugar-phosphate backbone of the DNA The heterocyclic rings of the DNAarrow_forwardChoose the correct gel electrophoretic pattern that would be seen in dideoxy sequence analysis of the DNADNA molecule shown below. pGGCGACCGATTAGTCCCATCGATGGG−OHarrow_forward
- When proteins are separated using native gel electrophoresis, size, shape, and charge control their rate of migration on the gel. Why does DNA separate based on size, and why do we not worry much about shape or charge?arrow_forwardA DNA fragment with 450 bp will be closer to the top (negative pole) of an electrophoresis gel than one with 2,500 bp.True or false?arrow_forwardMake 2 mL of 50 fold dilution of DNA solution and sodium phosphate buffer. DNA: 400 uL Sodium phosphate buffer, pH 6.9, 10mL - Calclate amount of DNA & buffer need to make dilutionarrow_forward
- Figure 9-22 shows the first steps in the process of making a DNA microarray, or DNA chip, using photolithography. Describe the remaining steps needed to obtain the desired sequences (a different fournucleotide sequence on each of the four spots) shown in the first panel of the figure. After each step, give the resulting nucleotide sequence attached at each spot.arrow_forwardAll of the following statements are correct EXCEPT a. DNA forms described by Watson and Crick have right handed helix except of Z-DNA form b. In case of Z-DNA form, the deoxyribose phosphate backbone forms a "Zigzag structure" c. Inverted DNA sequence repeat that happens within each individual strand of the DNA, called cruciform d. Plasmid carries genes that convey antibiotic resistance to the host bacteriumarrow_forwardWhat do you mean by amphoteric substance? Give examples of substance that is/are amphoteric. What is the purpose of the power supply in gel electrophoresis? Among the short and long strand of DNA, which moves the farthest in the gel and why? What is the purpose of buffer in agarose gel electrophoresis?arrow_forward
- Concepts of BiologyBiologyISBN:9781938168116Author:Samantha Fowler, Rebecca Roush, James WisePublisher:OpenStax CollegeHuman Heredity: Principles and Issues (MindTap Co...BiologyISBN:9781305251052Author:Michael CummingsPublisher:Cengage Learning