Operons are characteristic feature of prokaryotes but these are absent in eukaryotes. Operon comprises of multiple genes arranged together with a promoter and an operator.

Question

Want to see the full answer?

Answer 1

Question

Chapter 7, Problem 6FIB

Summary Introduction

Introduction:

Operons are characteristic feature of prokaryotes but these are absent in eukaryotes. Operon comprises of multiple genes arranged together with a promoter and an operator.

Expert Solution & Answer

Want to see the full answer?

Check out a sample textbook solution

See solution

Students have asked these similar questions

The following is a sequence of the leader region ofthe his operon mRNA in Salmonella typhimurium.What bases in this sequence could cause a ribosometo pause when histidine is limiting (that is, when thereis very little of it) in the medium?5′ AUGACACGCGUUCAAUUUAAACACCACCAUCAUCACCAUCAUCCUGACUAGUCUUUCAGGC 3′

when tryptophan is present, what would happen to trp operon regulation

The symbols a, b, and c in the table below represent theE. coli lac system genes for the repressor (I ), the operator(O) region, and the β-galactosidase (Z), although notnecessarily in that order. Furthermore, the order inwhich the symbols are written in the genotypes is notnecessarily the actual sequence in the lac operon.Activity (+) or inactivity (−) of Z geneGenotype Inducer absent Inducer presenta- b+ c+ + +a+ b+ c- + +a+ b- c- - a+ b- c+/a- b+ c- + +a+ b+ c+/a- b- c- - +a+ b+ c-/a- b- c+ - +a- b+ c+/a+ b- c- + +a. Which symbol (a, b, or c) represents each of the lacgenes I, O, and Z ?b. In the table, a superscript minus sign on a gene symbolmerely indicates a mutant, but some mutant behaviorsin this system are given special mutant designations.Using the conventional gene symbols for the lac operon,designate each genotype in the table.

Answer 2

Question

Chapter 7, Problem 6FIB

Summary Introduction

Introduction:

Operons are characteristic feature of prokaryotes but these are absent in eukaryotes. Operon comprises of multiple genes arranged together with a promoter and an operator.

Expert Solution & Answer

Want to see the full answer?

Check out a sample textbook solution

See solution

Answer 3

Question

Chapter 7, Problem 6FIB

Summary Introduction

Introduction:

Operons are characteristic feature of prokaryotes but these are absent in eukaryotes. Operon comprises of multiple genes arranged together with a promoter and an operator.

Expert Solution & Answer

Want to see the full answer?

Check out a sample textbook solution

See solution

Answer 4

Question

Chapter 7, Problem 6FIB

Summary Introduction

Introduction:

Operons are characteristic feature of prokaryotes but these are absent in eukaryotes. Operon comprises of multiple genes arranged together with a promoter and an operator.

Expert Solution & Answer

Want to see the full answer?

Check out a sample textbook solution

See solution

Answer 5

Chapter 7, Problem 6FIB

Summary Introduction

Introduction:

Operons are characteristic feature of prokaryotes but these are absent in eukaryotes. Operon comprises of multiple genes arranged together with a promoter and an operator.

Answer 6

Chapter 7, Problem 6FIB

Summary Introduction

Introduction:

Operons are characteristic feature of prokaryotes but these are absent in eukaryotes. Operon comprises of multiple genes arranged together with a promoter and an operator.

Answer 7

Chapter 7, Problem 6FIB

Summary Introduction

Introduction:

Operons are characteristic feature of prokaryotes but these are absent in eukaryotes. Operon comprises of multiple genes arranged together with a promoter and an operator.

Answer 8

Expert Solution & Answer

Answer 9

Expert Solution & Answer

Answer 10

Want to see the full answer?

Check out a sample textbook solution

See solution

Answer 11

Ch. 7 - Which of the following is most likely the number...Ch. 7 - Which of the following is a true statement...Ch. 7 - Prob. 3MC Ch. 7 - Prob. 4MC Ch. 7 - Prob. 5MC Ch. 7 - Prob. 6MC Ch. 7 - Prob. 7MC Ch. 7 - Prob. 8MC Ch. 7 - Prob. 9MC Ch. 7 - Prob. 10MC

Operons are characteristic feature of prokaryotes but these are absent in eukaryotes. Operon comprises of multiple genes arranged together with a promoter and an operator.

Solution Summary: The author explains that inducible operons are inactive until the substrate of these genes' polypeptides is present. Repressed and induced operions are active till a repressor molecule inhibits it

Concept explainers

Videos

Introduction:

Operons are characteristic feature of prokaryotes but these are absent in eukaryotes. Operon comprises of multiple genes arranged together with a promoter and an operator.

Want to see the full answer?

Chapter 7 Solutions

Operons are characteristic feature of prokaryotes but these are absent in eukaryotes. Operon comprises of multiple genes arranged together with a promoter and an operator.

Solution Summary: The author explains that inducible operons are inactive until the substrate of these genes' polypeptides is present. Repressed and induced operions are active till a repressor molecule inhibits it

Concept explainers

Videos

Introduction: Operons are characteristic feature of prokaryotes but these are absent in eukaryotes. Operon comprises of multiple genes arranged together with a promoter and an operator.

Want to see the full answer?

Chapter 7 Solutions

Introduction:

Operons are characteristic feature of prokaryotes but these are absent in eukaryotes. Operon comprises of multiple genes arranged together with a promoter and an operator.