Ligases are also called as “synthetases”. Ligases catalyze the joining of two strands or molecules together by creating some types of bonds between them. Ligases play a very important role during replication of DNA and RNA.

Question

Want to see the full answer?

Answer 1

Question

Chapter 7, Problem 23MC

Summary Introduction

Introduction:

Ligases are also called as “synthetases”. Ligases catalyze the joining of two strands or molecules together by creating some types of bonds between them. Ligases play a very important role during replication of DNA and RNA.

Expert Solution & Answer

Want to see the full answer?

Check out a sample textbook solution

See solution

Students have asked these similar questions

Treating a cell with a drug to stop tRNA from doing its job would mean what? A. that ribosomes would fall apart B. that sugars woulf not be added to proteins C. that nothing would be available to translate D. that amino acids would not be brought to the growing protein.

A single template strand of a DNA molecule is represented by 3’atgtaccatgcgcaaatttaaaggccc5’. a) Imagine that AAG is an INTRON in the original DNA template strand above. Write the mature mRNA strand after the three modifications? b) Write the amino acid sequence of your mature mRNA. c) List the molecules involved in translation and briefly describe their function.

Use your genetic code (codon) table to answer the next two questions: What type of mutation would result if the sequence of a gene were altered so that the sequence of the mRNA was changed from: AUGCCGUGCAGUAAC to AUGCCAUGCAGUAAC A) a silent mutation B) a nonsense mutation C) a frame-shift mutation D) a missense mutation E) a base insertion mutation

Answer 2

Question

Chapter 7, Problem 23MC

Summary Introduction

Introduction:

Ligases are also called as “synthetases”. Ligases catalyze the joining of two strands or molecules together by creating some types of bonds between them. Ligases play a very important role during replication of DNA and RNA.

Expert Solution & Answer

Want to see the full answer?

Check out a sample textbook solution

See solution

Answer 3

Question

Chapter 7, Problem 23MC

Summary Introduction

Introduction:

Ligases are also called as “synthetases”. Ligases catalyze the joining of two strands or molecules together by creating some types of bonds between them. Ligases play a very important role during replication of DNA and RNA.

Expert Solution & Answer

Want to see the full answer?

Check out a sample textbook solution

See solution

Answer 4

Question

Chapter 7, Problem 23MC

Summary Introduction

Introduction:

Ligases are also called as “synthetases”. Ligases catalyze the joining of two strands or molecules together by creating some types of bonds between them. Ligases play a very important role during replication of DNA and RNA.

Expert Solution & Answer

Want to see the full answer?

Check out a sample textbook solution

See solution

Answer 5

Chapter 7, Problem 23MC

Summary Introduction

Introduction:

Ligases are also called as “synthetases”. Ligases catalyze the joining of two strands or molecules together by creating some types of bonds between them. Ligases play a very important role during replication of DNA and RNA.

Answer 6

Chapter 7, Problem 23MC

Summary Introduction

Introduction:

Ligases are also called as “synthetases”. Ligases catalyze the joining of two strands or molecules together by creating some types of bonds between them. Ligases play a very important role during replication of DNA and RNA.

Answer 7

Chapter 7, Problem 23MC

Summary Introduction

Introduction:

Ligases are also called as “synthetases”. Ligases catalyze the joining of two strands or molecules together by creating some types of bonds between them. Ligases play a very important role during replication of DNA and RNA.

Answer 8

Expert Solution & Answer

Answer 9

Expert Solution & Answer

Answer 10

Want to see the full answer?

Check out a sample textbook solution

See solution

Answer 11

Ch. 7 - Which of the following is most likely the number...Ch. 7 - Which of the following is a true statement...Ch. 7 - Prob. 3MC Ch. 7 - Prob. 4MC Ch. 7 - Prob. 5MC Ch. 7 - Prob. 6MC Ch. 7 - Prob. 7MC Ch. 7 - Prob. 8MC Ch. 7 - Prob. 9MC Ch. 7 - Prob. 10MC

Ligases are also called as “synthetases”. Ligases catalyze the joining of two strands or molecules together by creating some types of bonds between them. Ligases play a very important role during replication of DNA and RNA.

Solution Summary: The author explains that Ligases catalyze the joining of two strands or molecules together by creating some types of bonds between them.

Concept explainers

Videos

Introduction:

Ligases are also called as “synthetases”. Ligases catalyze the joining of two strands or molecules together by creating some types of bonds between them. Ligases play a very important role during replication of DNA and RNA.

Want to see the full answer?

Chapter 7 Solutions

Ligases are also called as “synthetases”. Ligases catalyze the joining of two strands or molecules together by creating some types of bonds between them. Ligases play a very important role during replication of DNA and RNA.

Solution Summary: The author explains that Ligases catalyze the joining of two strands or molecules together by creating some types of bonds between them.

Concept explainers

Videos

Introduction: Ligases are also called as “synthetases”. Ligases catalyze the joining of two strands or molecules together by creating some types of bonds between them. Ligases play a very important role during replication of DNA and RNA.

Want to see the full answer?

Chapter 7 Solutions

Introduction:

Ligases are also called as “synthetases”. Ligases catalyze the joining of two strands or molecules together by creating some types of bonds between them. Ligases play a very important role during replication of DNA and RNA.