Microbiology: With Diseases by Taxonomy - With Lab. Man
5th Edition
ISBN: 9780134589824
Author: BAUMAN
Publisher: PEARSON
expand_more
expand_more
format_list_bulleted
Concept explainers
Question
Chapter 7, Problem 8FIB
Summary Introduction
Introduction:
Horizontal gene transfer (HGT) is the movement of genetic material between unicellular or multicellular organisms. Other method of gene transfer is vertical gene transfer that takes place from parent to offspring. HGT is important in the evolution of many organisms. HGT is also the primary mechanism for the transfer of antibiotic resistance in bacteria.
Expert Solution & Answer
Want to see the full answer?
Check out a sample textbook solutionStudents have asked these similar questions
Please answer the following questions using numbers and not text. For example, if you think the answer is 24, write 24 and not twenty-four. If you think the answer is 24 ATP, write only the number 24.
As a microbiology technician, your job is to characterize a novel bacterial strain isolated from insects. Phenotypically, you have discovered that the new bacterial strain can grow in the presence or absence of oxygen. After genome sequencing and biochemical characterization, you know that your new organism is capable of making all of the enzymes necessary for glycolysis and the TCA cycle, and that it has an electron transport chain.
Answer the following questions based on the growth of your organism on minimal media plates containing only acetate as a carbon and energy source. Acetate is transported across the membrane at the cost of 3 ATP per molecule.
Each question should be answered based on the metabolism of one molecule of acetate. If you come up with a negative value, indicate an…
True or False and Explain answer. Bacteria that make a specific restriction nuclease for defense against viruses have evolved in such a way that their own genome does not contain the recognition sequence for that nuclease.
will be focusing on genetics as a whole, but also differentiating some specifics for bacterial genetics. The area where I want you to focus for this discussion is on a gene in a microorganism that provides a characteristic you find interesting. However, I want it to be a gene that is beneficial for the microbial cell, but allows for a negative impact related to the human. For example, some strains of Staphylococcus aureus have a gene, mecA, that makes them resistant to the antibiotic methicillin. They are commonly called methicillin-resistant S. aureus or MRSA. The gene is beneficial to the bacteria because it allows for their survival even in the presence of this antibiotic but is negative for humans because it limits what antibiotics can be used for treatment. There are a large range of options here including microbe structures as well as the production of various substances so don’t limit your search.
Chapter 7 Solutions
Microbiology: With Diseases by Taxonomy - With Lab. Man
Ch. 7 - Which of the following is most likely the number...Ch. 7 - Which of the following is a true statement...Ch. 7 - Prob. 3MCCh. 7 - Prob. 4MCCh. 7 - Prob. 5MCCh. 7 - Prob. 6MCCh. 7 - Prob. 7MCCh. 7 - Prob. 8MCCh. 7 - Prob. 9MCCh. 7 - Prob. 10MC
Ch. 7 - Which of the following is not a mechanism of...Ch. 7 - Prob. 12MCCh. 7 - Prob. 13MCCh. 7 - Which of the following are called jumping genes?...Ch. 7 - Prob. 15MCCh. 7 - Prob. 16MCCh. 7 - Prob. 17MCCh. 7 - Prob. 18MCCh. 7 - Prob. 19MCCh. 7 - Prob. 20MCCh. 7 - Prob. 21MCCh. 7 - Prob. 22MCCh. 7 - Prob. 23MCCh. 7 - Prob. 24MCCh. 7 - The trp operon is repressible. This means it is...Ch. 7 - The three steps in RNA transcription are...Ch. 7 - Prob. 2FIBCh. 7 - Prob. 3FIBCh. 7 - Prob. 4FIBCh. 7 - An operon consists of ____________,...Ch. 7 - Prob. 6FIBCh. 7 - A daughter DNA molecule is composed of one...Ch. 7 - Prob. 8FIBCh. 7 - Prob. 9FIBCh. 7 - ____________ is a recombination event that occurs...Ch. 7 - Prob. 11FIBCh. 7 - Prob. 12FIBCh. 7 - Prob. 1SACh. 7 - Prob. 2SACh. 7 - Prob. 3SACh. 7 - Polypeptide synthesis requires large amounts of...Ch. 7 - Prob. 5SACh. 7 - Prob. 6SACh. 7 - Prob. 7SACh. 7 - Prob. 8SACh. 7 - Describe how DNA is packaged in both prokaryotes...Ch. 7 - Prob. 10SACh. 7 - Prob. 11SACh. 7 - Prob. 12SACh. 7 - On the figure below, label DNA polymerase I, DNA...Ch. 7 - Prob. 2VICh. 7 - Prob. 3VICh. 7 - If molecules of mRNA have the following nucleotide...Ch. 7 - A scientist uses a molecule of DNA composed of...Ch. 7 - Prob. 3CTCh. 7 - Prob. 4CTCh. 7 - Prob. 5CTCh. 7 - Suppose that the E. coli gene for the lac operon...Ch. 7 - Prob. 7CTCh. 7 - Prob. 8CTCh. 7 - Prob. 9CTCh. 7 - How can knowledge of nucleotide analogs be useful...Ch. 7 - The endosymbiotic theory states that mitochondria...Ch. 7 - Prob. 12CTCh. 7 - Prob. 13CTCh. 7 - Prob. 14CTCh. 7 - Prob. 15CTCh. 7 - What DNA nucleotide triplet codes for codon UGU?...Ch. 7 - Prob. 17CTCh. 7 - Prob. 1CMCh. 7 - DNA replication requires a large amount of energy,...Ch. 7 - In bacteria, polypeptide translation can begin...Ch. 7 - Prob. 3TMWCh. 7 - Prob. 4TMWCh. 7 - Clinical Case Study Deadly Horizontal Gene...Ch. 7 - Emerging Disease Case Study Vibrio Vulnificus...
Knowledge Booster
Learn more about
Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.Similar questions
- With regards to this sequence below please answer this quistions 1) What is the format of the sequence below and why 2) What do you understand by a query sequence 3) What is the sequence size of this sequence 4) What is the ID of the sequence and indicate the taxonomic rank of the ID ATGAAAAAACGAAAAGTGTTAATACCATTAATGGCATTGTCTACGATATTAGTTTCAAGCACAGGTAATT TAGAGGTGATTCAGGCAGAAGTTAAACAGGAGAACCGGTTATTAAATGAATCAGAATCAAGTTCCCAGGG GTTACTAGGATACTATTTTAGTGATTTGAATTTTCAAGCACCCATGGTGGTTACCTCTTCTACTACAGGG GATTTATCTATTCCTAGTTCTGATAGAAAATATTCCATCGGAAAACCAATATTTTCAATCTGCTATTTGG TCAGGATTTATCAAAGTTAAGAAGAGTGATGAATATACATTTGCTACTTCCGCTGATAATCATGTAACAA TGTGGGTAGATGACCAACAAGTGATTAATAAAGCTTCTAATTCTAACAAAATCAGATTAGAAAAAGGA AGATTATATCAAATAAAAATTCAATATCAACGAGAAAATCCTACTGAAAAAGGATTGGATTTCAAGTTGT ACTGGACCGATTCTCAAAATAAAAAAGAAGTGATTTCTAGTGATAACTTACAATTGCCAGAATTAAAACA AAAATCTTCGAACTCAAGAAAAAAGCGAAGTACAAGTGTGGACCTACGGTTCCAGACCGTGACAATGAT GGAATCCCTGATTCATTAGAGGTAGAAGGATATACGGTTGATGTCAAAAATAAAAGAACTTTTCTTTCAC…arrow_forwardThis answer is copied, a sign of plagarism, I need a explanation not from the internetarrow_forwardPlease help me answer this reviewer. Write the word TRUE if the statement is correct and if not, underline the word or statement that makes the sentence incorrect and write the correct answer on the space provided. 1. CRISPR refers to the repeated sequences located in the viral DNA. answer: 2. In CRISPR, the guide RNA is designed to find and bind to a specific sequence in the DNA. answer: 3. PCR makes it possible to obtain multiple copies of DNA fragments from an extract. answer: 4. DNA is positively charged. answer: Thank you very much for your helparrow_forward
- Do the mRNA covid-19 vaccine have safety issues and does the mRNA vaccine is not safe? I need full depth explanation for this question. Please help me with that.arrow_forwardGive only typing answer with explanation and conclusion Information: 1_Green Fluorescent Protein 2_nucleotide sequence, Amino acid sequence, and primers are obtained. 3_PCR protocol already described 4_bp has been calculations and estimated agarose gel image already designed. Questions: How do you analyze whether your target protein is expressed by E. coli cells. Explain your analysis method in detail and give information about the results you expect (in detail please)arrow_forwardMeropenem is a carbapenem antibiotic. Which circle indicates the B-lac tam ring? Please define and explain your answer.arrow_forward
- Explanation of why mutations vary in likelihood of causing disease depending on location relative to a gene Explanation of what is a genetic test Explanation of the PCR method ALL RELATES TO Phenylketonuria PLEASEEEEEE ANSWER ALLLL PLEASEEEEarrow_forwardPlease choose the correct answer. Initial DNA nucleotides are added by reverse transcriptase from the primer binding site to the a. uracil rich 5’ end. b. uracil rich 3’ end. c. polypurine tract. d. ssDNA.arrow_forwardWhy is there some signal present within the ‘no sugar’ and other noninducing sugars for the green fluorescence protein when under the control of an arabinose promoter? Please answer asap and type your answer and do not copy from anywhere pleasearrow_forward
- This is an ungraded question about gene order that I found confusing. If this question possibly violates the honor code, can I have another question that addressses this concept?arrow_forwardComputate bioinformatically the Tm value, the GC-content of the selected DNA sequence and the absolute nucleotide composition of the selected gene. Please provide also the tool source of the computation. Sickle Cell Anemia is the disease being used. Please answer the question using sickle cell anemiaarrow_forwardWhat is the genus and species of your bacteria? And What led you to confirm this result and why? Please discuss. ☆My bacteria is Alcaligenes faecalisarrow_forward
arrow_back_ios
SEE MORE QUESTIONS
arrow_forward_ios
Recommended textbooks for you
- Human Anatomy & Physiology (11th Edition)BiologyISBN:9780134580999Author:Elaine N. Marieb, Katja N. HoehnPublisher:PEARSONBiology 2eBiologyISBN:9781947172517Author:Matthew Douglas, Jung Choi, Mary Ann ClarkPublisher:OpenStaxAnatomy & PhysiologyBiologyISBN:9781259398629Author:McKinley, Michael P., O'loughlin, Valerie Dean, Bidle, Theresa StouterPublisher:Mcgraw Hill Education,
- Molecular Biology of the Cell (Sixth Edition)BiologyISBN:9780815344322Author:Bruce Alberts, Alexander D. Johnson, Julian Lewis, David Morgan, Martin Raff, Keith Roberts, Peter WalterPublisher:W. W. Norton & CompanyLaboratory Manual For Human Anatomy & PhysiologyBiologyISBN:9781260159363Author:Martin, Terry R., Prentice-craver, CynthiaPublisher:McGraw-Hill Publishing Co.Inquiry Into Life (16th Edition)BiologyISBN:9781260231700Author:Sylvia S. Mader, Michael WindelspechtPublisher:McGraw Hill Education
Human Anatomy & Physiology (11th Edition)
Biology
ISBN:9780134580999
Author:Elaine N. Marieb, Katja N. Hoehn
Publisher:PEARSON
Biology 2e
Biology
ISBN:9781947172517
Author:Matthew Douglas, Jung Choi, Mary Ann Clark
Publisher:OpenStax
Anatomy & Physiology
Biology
ISBN:9781259398629
Author:McKinley, Michael P., O'loughlin, Valerie Dean, Bidle, Theresa Stouter
Publisher:Mcgraw Hill Education,
Molecular Biology of the Cell (Sixth Edition)
Biology
ISBN:9780815344322
Author:Bruce Alberts, Alexander D. Johnson, Julian Lewis, David Morgan, Martin Raff, Keith Roberts, Peter Walter
Publisher:W. W. Norton & Company
Laboratory Manual For Human Anatomy & Physiology
Biology
ISBN:9781260159363
Author:Martin, Terry R., Prentice-craver, Cynthia
Publisher:McGraw-Hill Publishing Co.
Inquiry Into Life (16th Edition)
Biology
ISBN:9781260231700
Author:Sylvia S. Mader, Michael Windelspecht
Publisher:McGraw Hill Education
Bacterial Genomics and Metagenomics; Author: Quadram Institute;https://www.youtube.com/watch?v=_6IdVTAFXoU;License: Standard youtube license