Microbiology: With Diseases by Taxonomy - With Lab. Man
Microbiology: With Diseases by Taxonomy - With Lab. Man
5th Edition
ISBN: 9780134589824
Author: BAUMAN
Publisher: PEARSON
bartleby

Concept explainers

bartleby

Videos

Question
Book Icon
Chapter 7, Problem 12CT
Summary Introduction

To determine:

The reason behind the fact that the two strands of DNA are not effectively linked by covalent bonds.

Concept introduction:

Deoxyribonucleic acid DNA is a double helical structure found in nucleus of eukaryotic cells. The two strands of DNA are connected with each other that offers a great stability to DNA.

Blurred answer
Students have asked these similar questions
One strand of a double-helical DNA has the sequence (5′)GCGCAATATTTCTCAAAATATTGCGC(3′). Write the base sequence of the complementary strand. What special type of sequence is contained in thisDNA segment? Does the double-stranded DNA have the potential to form any alternative structures?
Why is it unfavorable for RNA molecules to adopt a double-helix structure similar to B-DNA?     Because it is entropically unfavorable     Because that would cause a steric clash between the sugars and nucleobases      Because that would cause a steric clash between the 2' OHs of the sugars and the phosphates     Because uracil can't form hydrogen bonds with any other nucleobases
Using the straight-chain sugar convention where the vertical lines represent sugars and the diagonals are phosphodiester bonds, choose the correct structure of the DNADNA strand that encoded this short stretch of RNA. pppApCpUpGpGpCpApA−OH

Chapter 7 Solutions

Microbiology: With Diseases by Taxonomy - With Lab. Man

Ch. 7 - Which of the following is not a mechanism of...Ch. 7 - Prob. 12MCCh. 7 - Prob. 13MCCh. 7 - Which of the following are called jumping genes?...Ch. 7 - Prob. 15MCCh. 7 - Prob. 16MCCh. 7 - Prob. 17MCCh. 7 - Prob. 18MCCh. 7 - Prob. 19MCCh. 7 - Prob. 20MCCh. 7 - Prob. 21MCCh. 7 - Prob. 22MCCh. 7 - Prob. 23MCCh. 7 - Prob. 24MCCh. 7 - The trp operon is repressible. This means it is...Ch. 7 - The three steps in RNA transcription are...Ch. 7 - Prob. 2FIBCh. 7 - Prob. 3FIBCh. 7 - Prob. 4FIBCh. 7 - An operon consists of ____________,...Ch. 7 - Prob. 6FIBCh. 7 - A daughter DNA molecule is composed of one...Ch. 7 - Prob. 8FIBCh. 7 - Prob. 9FIBCh. 7 - ____________ is a recombination event that occurs...Ch. 7 - Prob. 11FIBCh. 7 - Prob. 12FIBCh. 7 - Prob. 1SACh. 7 - Prob. 2SACh. 7 - Prob. 3SACh. 7 - Polypeptide synthesis requires large amounts of...Ch. 7 - Prob. 5SACh. 7 - Prob. 6SACh. 7 - Prob. 7SACh. 7 - Prob. 8SACh. 7 - Describe how DNA is packaged in both prokaryotes...Ch. 7 - Prob. 10SACh. 7 - Prob. 11SACh. 7 - Prob. 12SACh. 7 - On the figure below, label DNA polymerase I, DNA...Ch. 7 - Prob. 2VICh. 7 - Prob. 3VICh. 7 - If molecules of mRNA have the following nucleotide...Ch. 7 - A scientist uses a molecule of DNA composed of...Ch. 7 - Prob. 3CTCh. 7 - Prob. 4CTCh. 7 - Prob. 5CTCh. 7 - Suppose that the E. coli gene for the lac operon...Ch. 7 - Prob. 7CTCh. 7 - Prob. 8CTCh. 7 - Prob. 9CTCh. 7 - How can knowledge of nucleotide analogs be useful...Ch. 7 - The endosymbiotic theory states that mitochondria...Ch. 7 - Prob. 12CTCh. 7 - Prob. 13CTCh. 7 - Prob. 14CTCh. 7 - Prob. 15CTCh. 7 - What DNA nucleotide triplet codes for codon UGU?...Ch. 7 - Prob. 17CTCh. 7 - Prob. 1CMCh. 7 - DNA replication requires a large amount of energy,...Ch. 7 - In bacteria, polypeptide translation can begin...Ch. 7 - Prob. 3TMWCh. 7 - Prob. 4TMWCh. 7 - Clinical Case Study Deadly Horizontal Gene...Ch. 7 - Emerging Disease Case Study Vibrio Vulnificus...
Knowledge Booster
Background pattern image
Biology
Learn more about
Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.
Similar questions
SEE MORE QUESTIONS
Recommended textbooks for you
Text book image
Human Heredity: Principles and Issues (MindTap Co...
Biology
ISBN:9781305251052
Author:Michael Cummings
Publisher:Cengage Learning
Molecular Techniques: Basic Concepts; Author: Dr. A's Clinical Lab Videos;https://www.youtube.com/watch?v=7HFHZy8h6z0;License: Standard Youtube License