MICRO. FUND. CONNECT CODE W/VIRTUAL LAB
MICRO. FUND. CONNECT CODE W/VIRTUAL LAB
3rd Edition
ISBN: 9781266313806
Author: Cowan
Publisher: INTER MCG
bartleby

Concept explainers

bartleby

Videos

Question
Book Icon
Chapter 8, Problem 12Q

(i)

Summary Introduction

To create:

The frame shift mutation from the DNA sequence: TAC CAG ATA CAC TCC CCT

Introduction:

The mutation which occurs in introns is insertion or deletion. It can cause shift in open reading frame of the gene sequence, and can change the amino acid sequence of the coded protein.

(i)

Expert Solution
Check Mark

Explanation of Solution

Change in the genetic sequence of DNA, by addition and deletion of nucleotides, results in gene mutation.

Insertion mutation: This mutation occurs by insertion of one or more nucleotides in the DNA sequence. Insertion mutation is a type of frame shift mutation, as insertion of a single nucleotide shifts the whole reading frame in the DNA.

Original DNA sequence: TAC_CAG_ATA_CAC_TCC_CCT_

Frame shift due to insertion mutation: TAC_CCA_GAT_ACA_CTC_CCC_T

Deletion mutation: This mutation occurs due to removal of one or more nucleotides from DNA sequence. Deletion mutation is a type of frame shift mutation, as removal of a single nucleotide shifts the whole reading frame in the DNA.

Original DNA sequence: TAC_CAG_ATA_CAC_TCC_CCT_

Frame shift due to deletion mutation: TAC_CAG_ATA_CAC_TCC_CCT_TAC_CAG_AAC_ACT_CCC_CT

(ii)

Summary Introduction

To create:

The silent mutation from the DNA sequence: TAC CAG ATA CAC TCC CCT

Introduction:

The mutations in the codons that do not change the particular amino acid in the given polypeptide chain are called synonymous mutations. They are also called silent mutations because they cause no change in the structure of the protein.

(ii)

Expert Solution
Check Mark

Explanation of Solution

Silent mutation involves base substitution which results in same amino acids that was encoded by previous nucleotidal sequence.

Original DNA sequence: TAC_CAG_ATA_CAC_TCC_CCT_

Corresponding RNA sequence: UAC_ CAG_ AUA_ CAC_ UCC_ CCU_

Amino acid sequence: Tyrosine Glutamine Methionine Histidine Serine Proline

Silent mutation: TAC_CAG_ATA_CAC_TCC_CCT_TAT_CAG_ATA_CAC_TCC_CCT_

Corresponding RNA sequence: UAU_ CAA_ AUG_ CAU_ UCU_ CCC_

Amino acid sequence: Tyrosine Glutamine Methionine Histidine Serine Proline

(iii)

Summary Introduction

To create:

The nonsense mutation from the DNA sequence: TAC CAG ATA CAC TCC CCT

Introduction:

The nonsense mutations are the mutations that generate the stop codon. The generated stop codon terminates the translational process and thus, the protein structure will not be formed because no more amino acids will be added to the sequence.

(iii)

Expert Solution
Check Mark

Explanation of Solution

Nonsense mutation involves substitution of a single base pair that yields a stop codon.

Original DNA sequence: TAC_CAG_ATA_CAC_TCC_CCT_

Nonsense mutation: TAG_CAG_ATA_CAC_TCC_CCT_

Corresponding RNA sequence: UAG_ CAG_ AUA_ CAC_ UCC_ CCU_Stopcodon

Want to see more full solutions like this?

Subscribe now to access step-by-step solutions to millions of textbook problems written by subject matter experts!
Students have asked these similar questions
The following is a list of mutational changes. For eachof the specific mutations described, indicate which ofthe terms in the right-hand column applies, either as adescription of the mutation or as a possible cause.More than one term from the right column can applyto each statement in the left column.1. an A–T base pair in the wild-type gene ischanged to a G–C pair2. an A–T base pair is changed to a T–A pair3. the sequence AAGCTTATCG is changed toAAGCTATCG4. the sequence CAGCAGCAGCAGCAGCAGis changed toCAGCAGCAGCAGCAGCAGCAGCAG5. the sequence AACGTTATCG is changed toAATGTTATCG6. the sequence AACGTCACACACACATCGis changed to AACGTCACATCG7. the sequence AAGCTTATCG is changed toAAGCTTTATCGa. transitionb. basesubstitutionc. transversiond. deletione. insertionf. deaminationg. X-rayirradiationh. intercalatori. slippedmispairing
All questions  a) State the type of gene mutation shown in Figure 2.  b) Name the genetic disorder that would arise from this mutation.  c) What is the difference(s) between gene mutation shown in Figure 2 from a frameshift mutation?
Two possible point mutations are the substitution of lysine for leucine or the substitution of serine for threonine. Which is likely to be more serious and why?

Chapter 8 Solutions

MICRO. FUND. CONNECT CODE W/VIRTUAL LAB

Ch. 8.2 - Prob. 10AYPCh. 8.2 - Identify the locations of the promoter, the start...Ch. 8.2 - Indicate how eukaryotic transcription and...Ch. 8.2 - NCLEX PREP 2. The following are all true of RNA,...Ch. 8.2 - Prob. 3NPCh. 8.3 - Define the term operon, and explain one advantage...Ch. 8.3 - Prob. 14AYPCh. 8.4 - Prob. 15AYPCh. 8.4 - Prob. 16AYPCh. 8.5 - Prob. 17AYPCh. 8.5 - Differentiate among frameshift, nonsense, silent,...Ch. 8.5 - Prob. 19AYPCh. 8.5 - Prob. 1MMCh. 8.6 - Explain the importance of restriction...Ch. 8.6 - List the steps in the polymerase chain reaction.Ch. 8.6 - Describe how you can clone a gene into a...Ch. 8.6 - Prob. 23AYPCh. 8.6 - Prob. 24AYPCh. 8.6 - Name two genetic techniques that are designed to...Ch. 8.6 - NCLEX PREF 4. A client is being treated with...Ch. 8.6 - Prob. 2MMCh. 8 - Single nucleotide polymorphisms are found in a....Ch. 8 - Using your knowledge of DNA from this chapter,...Ch. 8 - Conduct research on CRISPR and explain in...Ch. 8 - Which of the following is a characteristic of RNA?...Ch. 8 - List some advantages and disadvantages to a cell...Ch. 8 - Construct an argument for why tRNA contains a lot...Ch. 8 - Prob. 7QCh. 8 - Discuss the intersection between the metabolome...Ch. 8 - Defend this statement: All of biology is dependent...Ch. 8 - DNA is semiconservative because the ______ strand...Ch. 8 - Examine the DNA triplets here and determine the...Ch. 8 - Prob. 12QCh. 8 - Prob. 13QCh. 8 - Prob. 14QCh. 8 - Metagenomics is providing insight into the...Ch. 8 - The creation of biological molecules and cells...Ch. 8 - Prob. 17QCh. 8 - Genetically modified organisms (GMOs)especially in...Ch. 8 - Prob. 19QCh. 8 - Construct an analogy using your clothes closet to...Ch. 8 - Prob. 21QCh. 8 - Prob. 1VC
Knowledge Booster
Background pattern image
Biology
Learn more about
Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.
Similar questions
SEE MORE QUESTIONS
Recommended textbooks for you
Text book image
Human Heredity: Principles and Issues (MindTap Co...
Biology
ISBN:9781305251052
Author:Michael Cummings
Publisher:Cengage Learning
Text book image
Biology Today and Tomorrow without Physiology (Mi...
Biology
ISBN:9781305117396
Author:Cecie Starr, Christine Evers, Lisa Starr
Publisher:Cengage Learning
Mitochondrial mutations; Author: Useful Genetics;https://www.youtube.com/watch?v=GvgXe-3RJeU;License: CC-BY