To answer: Recognition and restriction of DNA sequence by Hha I. Introduction: Restriction enzymes recognize and cut DNA nucleotide sequences at the specific sites is called restriction site. Most of the restriction sites are palindromic sequences (the sequence can be read both forward or backward). The hundreds of restriction enzymes are classified into two groups based on their types of cuts (sticky or blunt ends) on DNA sequences. Eco RI cuts DNA sequence and both ends have overhanging ssDNA pieces (staggered cut) is called sticky ends. Hind II and Sma I cut dsDNA at the same point and produced blunt ends. In bacteria, restriction enzymes are used for their protection from phages, which are cleaved by restriction enzymes into nonfunctional nucleotide pieces. However, bacterial DNAs are protected by methylation mechanism. Restriction enzymes are mostly denoted by three or more letters which indicates their genus and bacterial sources.

Question

Want to see the full answer?

Answer 1

Question

Chapter 8, Problem 5CT

Summary Introduction

To answer:

Recognition and restriction of DNA sequence by HhaI.

Introduction:

Restriction enzymes recognize and cut DNA nucleotide sequences at the specific sites is called restriction site. Most of the restriction sites are palindromic sequences (the sequence can be read both forward or backward). The hundreds of restriction enzymes are classified into two groups based on their types of cuts (sticky or blunt ends) on DNA sequences. EcoRI cuts DNA sequence and both ends have overhanging ssDNA pieces (staggered cut) is called sticky ends. HindII and SmaI cut dsDNA at the same point and produced blunt ends. In bacteria, restriction enzymes are used for their protection from phages, which are cleaved by restriction enzymes into nonfunctional nucleotide pieces. However, bacterial DNAs are protected by methylation mechanism. Restriction enzymes are mostly denoted by three or more letters which indicates their genus and bacterial sources.

Expert Solution & Answer

Want to see the full answer?

Check out a sample textbook solution

See solution

Students have asked these similar questions

Is there any situation in which DNA is made based on a RNA template? If there is,explain with an example how it occurs and state the enzyme involved?

Given the following coding sequence for DNA, provide the sequence of the complementary(template) sequence. 5’ ATGCATAGATTAGGATATCCCAGATAG 3’

true or false: DNA ligase seals nicks between DNA fragments by forming a new phosphate bond.

Answer 2

Question

Chapter 8, Problem 5CT

Summary Introduction

To answer:

Recognition and restriction of DNA sequence by HhaI.

Introduction:

Restriction enzymes recognize and cut DNA nucleotide sequences at the specific sites is called restriction site. Most of the restriction sites are palindromic sequences (the sequence can be read both forward or backward). The hundreds of restriction enzymes are classified into two groups based on their types of cuts (sticky or blunt ends) on DNA sequences. EcoRI cuts DNA sequence and both ends have overhanging ssDNA pieces (staggered cut) is called sticky ends. HindII and SmaI cut dsDNA at the same point and produced blunt ends. In bacteria, restriction enzymes are used for their protection from phages, which are cleaved by restriction enzymes into nonfunctional nucleotide pieces. However, bacterial DNAs are protected by methylation mechanism. Restriction enzymes are mostly denoted by three or more letters which indicates their genus and bacterial sources.

Expert Solution & Answer

Want to see the full answer?

Check out a sample textbook solution

See solution

Answer 3

Question

Chapter 8, Problem 5CT

Summary Introduction

To answer:

Recognition and restriction of DNA sequence by HhaI.

Introduction:

Restriction enzymes recognize and cut DNA nucleotide sequences at the specific sites is called restriction site. Most of the restriction sites are palindromic sequences (the sequence can be read both forward or backward). The hundreds of restriction enzymes are classified into two groups based on their types of cuts (sticky or blunt ends) on DNA sequences. EcoRI cuts DNA sequence and both ends have overhanging ssDNA pieces (staggered cut) is called sticky ends. HindII and SmaI cut dsDNA at the same point and produced blunt ends. In bacteria, restriction enzymes are used for their protection from phages, which are cleaved by restriction enzymes into nonfunctional nucleotide pieces. However, bacterial DNAs are protected by methylation mechanism. Restriction enzymes are mostly denoted by three or more letters which indicates their genus and bacterial sources.

Expert Solution & Answer

Want to see the full answer?

Check out a sample textbook solution

See solution

Answer 4

Question

Chapter 8, Problem 5CT

Summary Introduction

To answer:

Recognition and restriction of DNA sequence by HhaI.

Introduction:

Restriction enzymes recognize and cut DNA nucleotide sequences at the specific sites is called restriction site. Most of the restriction sites are palindromic sequences (the sequence can be read both forward or backward). The hundreds of restriction enzymes are classified into two groups based on their types of cuts (sticky or blunt ends) on DNA sequences. EcoRI cuts DNA sequence and both ends have overhanging ssDNA pieces (staggered cut) is called sticky ends. HindII and SmaI cut dsDNA at the same point and produced blunt ends. In bacteria, restriction enzymes are used for their protection from phages, which are cleaved by restriction enzymes into nonfunctional nucleotide pieces. However, bacterial DNAs are protected by methylation mechanism. Restriction enzymes are mostly denoted by three or more letters which indicates their genus and bacterial sources.

Expert Solution & Answer

Want to see the full answer?

Check out a sample textbook solution

See solution

Answer 5

Chapter 8, Problem 5CT

Summary Introduction

To answer:

Recognition and restriction of DNA sequence by HhaI.

Introduction:

Restriction enzymes recognize and cut DNA nucleotide sequences at the specific sites is called restriction site. Most of the restriction sites are palindromic sequences (the sequence can be read both forward or backward). The hundreds of restriction enzymes are classified into two groups based on their types of cuts (sticky or blunt ends) on DNA sequences. EcoRI cuts DNA sequence and both ends have overhanging ssDNA pieces (staggered cut) is called sticky ends. HindII and SmaI cut dsDNA at the same point and produced blunt ends. In bacteria, restriction enzymes are used for their protection from phages, which are cleaved by restriction enzymes into nonfunctional nucleotide pieces. However, bacterial DNAs are protected by methylation mechanism. Restriction enzymes are mostly denoted by three or more letters which indicates their genus and bacterial sources.

Answer 6

Chapter 8, Problem 5CT

Summary Introduction

To answer:

Recognition and restriction of DNA sequence by HhaI.

Introduction:

Restriction enzymes recognize and cut DNA nucleotide sequences at the specific sites is called restriction site. Most of the restriction sites are palindromic sequences (the sequence can be read both forward or backward). The hundreds of restriction enzymes are classified into two groups based on their types of cuts (sticky or blunt ends) on DNA sequences. EcoRI cuts DNA sequence and both ends have overhanging ssDNA pieces (staggered cut) is called sticky ends. HindII and SmaI cut dsDNA at the same point and produced blunt ends. In bacteria, restriction enzymes are used for their protection from phages, which are cleaved by restriction enzymes into nonfunctional nucleotide pieces. However, bacterial DNAs are protected by methylation mechanism. Restriction enzymes are mostly denoted by three or more letters which indicates their genus and bacterial sources.

Answer 7

Chapter 8, Problem 5CT

Summary Introduction

To answer:

Recognition and restriction of DNA sequence by HhaI.

Introduction:

Restriction enzymes recognize and cut DNA nucleotide sequences at the specific sites is called restriction site. Most of the restriction sites are palindromic sequences (the sequence can be read both forward or backward). The hundreds of restriction enzymes are classified into two groups based on their types of cuts (sticky or blunt ends) on DNA sequences. EcoRI cuts DNA sequence and both ends have overhanging ssDNA pieces (staggered cut) is called sticky ends. HindII and SmaI cut dsDNA at the same point and produced blunt ends. In bacteria, restriction enzymes are used for their protection from phages, which are cleaved by restriction enzymes into nonfunctional nucleotide pieces. However, bacterial DNAs are protected by methylation mechanism. Restriction enzymes are mostly denoted by three or more letters which indicates their genus and bacterial sources.

Answer 8

Expert Solution & Answer

Answer 9

Expert Solution & Answer

Answer 10

Want to see the full answer?

Check out a sample textbook solution

See solution

Answer 11

Ch. 8 - Why arent the terms recombinant DNA technology...Ch. 8 - Prob. 2TMW Ch. 8 - Why wasnt polymerase chain reaction (PCR)...Ch. 8 - Why dont doctors routinely insert genes into their...Ch. 8 - Prob. 5TMW Ch. 8 - Which of the following statements is true...Ch. 8 - A DNA gene synthesized from an RNA template is...Ch. 8 - Prob. 3MC Ch. 8 - Prob. 4MC Ch. 8 - Prob. 5MC

Solution Summary: The author explains that Hha I restriction enzymes recognize and cut DNA nucleotide sequences at the specific sites is called restriction site.

Concept explainers

Videos

Want to see the full answer?

Chapter 8 Solutions