Brock Biology of Microorganisms, Books a la Carte Plus Mastering Microbiology with eText -- Access Card Package (14th Edition)
14th Edition
ISBN: 9780321948304
Author: Michael T. Madigan, John M. Martinko, Kelly S. Bender, Daniel H. Buckley, David A. Stahl
Publisher: PEARSON
expand_more
expand_more
format_list_bulleted
Concept explainers
Videos
Textbook Question
Chapter 9, Problem 1AQ
Not all proteins are made from the RNA genome of bacteriophage MS2 in the same amounts. Can you explain why? One of the proteins functions very much like a repressor, but it functions at the translational level. Which protein is it and how does it function?
Expert Solution & Answer
Want to see the full answer?
Check out a sample textbook solution
Students have asked these similar questions
Not all proteins are made from the RNA genome ofbacteriophage MS2 in the same amounts. Can you explainwhy? One of the proteins functions very much like a repressor,but it functions at the translational level. Which protein is itand how does it function?
In bacterial cells, translation can begin before transcription of a gene is complete. Can this happen in our cells? Why or why not?
Why can it be said that transcription of thebacteriophage T7 genome requires two enzymes?
Chapter 9 Solutions
Brock Biology of Microorganisms, Books a la Carte Plus Mastering Microbiology with eText -- Access Card Package (14th Edition)
Ch. 9.1 - Distinguish between a positive-strand RNA virus...Ch. 9.1 - Prob. 2MQCh. 9.1 - Prob. 3MQCh. 9.2 - Prob. 1MQCh. 9.2 - Prob. 2MQCh. 9.2 - Prob. 3MQCh. 9.3 - Prob. 1MQCh. 9.3 - In the X174 genome, describe the difference...Ch. 9.3 - Prob. 3MQCh. 9.4 - In what major way does transcription of phage DNA...
Ch. 9.4 - Prob. 2MQCh. 9.5 - What type of genome is seen in most archaeal...Ch. 9.5 - Compared with other archaeal viruses, what are two...Ch. 9.6 - Prob. 1MQCh. 9.6 - Prob. 2MQCh. 9.6 - Prob. 3MQCh. 9.7 - Prob. 1MQCh. 9.7 - Prob. 2MQCh. 9.7 - Prob. 3MQCh. 9.8 - Prob. 1MQCh. 9.8 - Prob. 2MQCh. 9.8 - How are protein synthesis and genomic replication...Ch. 9.9 - Prob. 1MQCh. 9.9 - Prob. 2MQCh. 9.9 - Prob. 3MQCh. 9.10 - Prob. 1MQCh. 9.10 - Prob. 2MQCh. 9.10 - Prob. 3MQCh. 9.11 - Prob. 1MQCh. 9.11 - Prob. 2MQCh. 9.11 - How does the role of reverse transcriptase in the...Ch. 9.12 - If viroids are circular molecules, why are they...Ch. 9.12 - Prob. 2MQCh. 9.13 - Prob. 1MQCh. 9.13 - Prob. 2MQCh. 9.13 - Prob. 3MQCh. 9 - Prob. 1RQCh. 9 - Describe the classes of viruses based on their...Ch. 9 - REVIEW QUESTIONS
3. How might viruses help...Ch. 9 - Prob. 4RQCh. 9 - Describe how the genome of bacteriophage X174 is...Ch. 9 - Why can it be said that transcription of the...Ch. 9 - Prob. 7RQCh. 9 - Prob. 8RQCh. 9 - Prob. 9RQCh. 9 - Prob. 10RQCh. 9 - Prob. 11RQCh. 9 - Prob. 12RQCh. 9 - Prob. 13RQCh. 9 - Prob. 14RQCh. 9 - Rabies virus and poliovirus both have...Ch. 9 - Prob. 16RQCh. 9 - Why do both hepadnaviruses and retroviruses...Ch. 9 - Prob. 18RQCh. 9 - What are the similarities and differences between...Ch. 9 - Prob. 20RQCh. 9 - Not all proteins are made from the RNA genome of...Ch. 9 - Replication of both strands of DNA in adenoviruses...Ch. 9 - Imagine that you are a researcher at a...Ch. 9 - Prob. 4AQ
Knowledge Booster
Learn more about
Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.Similar questions
- If an extra nucleotide is inserted in the first exon of the beta globin gene, what effect will it have on the amino acid sequence of the globin polypeptides? Will the globin most likely be fully functional, partly functional, or nonfunctional? Why?arrow_forwardSome of the mutations of the type mentioned in Problem 28 have an interesting property: they prevent the formation of the antiterminator that normally takes place when the tryptophan level is low. In one of these mutations, the AUG start codon for translation of the 5′ UTR has been deleted. How might this mutation prevent antitermination from taking place?arrow_forwardWhy is it advantageous to have a mechanism to override the effect of stop codons in protein synthesis?arrow_forward
- A mutation is found in a tRNA-encoding gene. The wild type (non-mutant) allele (version) produces a tRNA that recognizes the codon GAA, and is charged with the amino acid glutamic acid (Glu). The mutant tRNA is still charged with Glu, but it recognizes the codon UAA. What effect will this have on translation in these cells? How will the proteins produced be different? Speculate: is this mutation more likely to be beneficial or harmful?arrow_forwardA codon that specifies the amino acid Gly undergoes a single-base substitution to become a nonsense mutation. In accord with the genetic code given in Figure 15.10, is this mutation a transition or a transversion? At which position of the codon does the mutation occur?arrow_forwardThe first amino acid in a purified bacterial protein is methionine. The start codon in the mRNA is GUG, which codes for valine. Why isn’t the first amino acid formylmethionine or valine?arrow_forward
- The 5′ region of the TPP riboswitch in Bacillus subtilis is very similar to the TPP riboswitch in E. coli. Even so, the riboswitch in B. subtilis regulates transcription, whereas the one in E. coli regulates translation. What is the role of the 5′ region in both riboswitches? How can one riboswitch regulate transcription while the other regulates translation?arrow_forwardWhich of these choices represents one possible corresponding mRNA sequence that can be transcribed from the following DNA template? 5′ - CTGTATCCTAGCACCCAAATCGCATTAGGAC - 3′arrow_forwardA certain gene in a bacterium codes for a polypeptide that is 400 amino acids long. How many nucleotides are needed in the mRNA to code for this polypeptide?arrow_forward
- You find that a diploid specimen in the lab has a mutation in a tRNA gene on one of its chromosomes. The anticodon of this variant tRNA has changed from 5’ UUC 3’ to 5’ UUA 3’, but can still be charged with its typical amino acid. What amino acid is normallybound to this tRNA and what predicted effect would it have on protein translation? Be specific.arrow_forwardBacteria use the same stop codons as eukaryotes. However, bacterial transcription is also terminated in places where the mRNA folds back on itself to form a hairpin-looped structure like the one shown below. How do you think that this structure stops transcription?arrow_forwardVaccina virus (used in the polio vaccine) produces an enzyme that takes the 5’ cap off of the mRNAs in the eukaryotic cells it infects. Besides allowing degradation of the host’s mRNA, what step in translation of the host’s mRNAs does this prevent? Group of answer choices Movement of tRNA from the A site to the P site tRNA binding to the A site Recognition of the stop codon Ribosome small subunit from binding mRNA Movement of the tRNA from the P site to the A sitearrow_forward
arrow_back_ios
SEE MORE QUESTIONS
arrow_forward_ios
Recommended textbooks for you
Human Heredity: Principles and Issues (MindTap Co...BiologyISBN:9781305251052Author:Michael CummingsPublisher:Cengage Learning
Biology Today and Tomorrow without Physiology (Mi...BiologyISBN:9781305117396Author:Cecie Starr, Christine Evers, Lisa StarrPublisher:Cengage Learning
Human Heredity: Principles and Issues (MindTap Co...
Biology
ISBN:9781305251052
Author:Michael Cummings
Publisher:Cengage Learning
Biology Today and Tomorrow without Physiology (Mi...
Biology
ISBN:9781305117396
Author:Cecie Starr, Christine Evers, Lisa Starr
Publisher:Cengage Learning
Bacterial Genomics and Metagenomics; Author: Quadram Institute;https://www.youtube.com/watch?v=_6IdVTAFXoU;License: Standard youtube license