EBK STARTING OUT WITH PROGRAMMING LOGIC
4th Edition
ISBN: 8220100659386
Author: GADDIS
Publisher: PEARSON
expand_more
expand_more
format_list_bulleted
Concept explainers
Expert Solution & Answer
Chapter 9, Problem 1AW
Explanation of Solution
Module swap(Real Ref x, Real Ref y)
Declare Real temp
Set temp = x
Set x = y
Set y = temp
End Module
Explanation for above given module:
The above swap module accepts two real arguments “x” and “y”...
Expert Solution & Answer
Want to see the full answer?
Check out a sample textbook solutionStudents have asked these similar questions
Design a swap module that accepts two arguments of the Real data type and swaps them.
In C Language, take an infix expression from the user and write a program to check the bracket evaluation of the expression.
Do not user pointers and make your code as efficient as possible.
pointers as Arguments:In the C programming language there is no pass-by-reference syntax to passa variable by reference to a function. Instead a variable is passed by pointer(just to be confusing, sometimes passing by pointer is referred to as pass byreference). This Practice Program asks you to do the same thing as C.Here is the header for a function that takes as input a pointer to an integer:1. void addOne (int ∗ptrNum )Complete the function so it adds one to the integer referenced by ptrNum.Write a main function where an integer variable is defined, give it an initialvalue, call addOne, and output the variable. It should be incremented by 1.
Chapter 9 Solutions
EBK STARTING OUT WITH PROGRAMMING LOGIC
Ch. 9.3 - Which of the sorting algorithms discussed makes...Ch. 9.3 - Prob. 9.2CPCh. 9.3 - Prob. 9.3CPCh. 9.4 - Prob. 9.4CPCh. 9.4 - On average, with an array of 1,000 elements, how...Ch. 9.4 - Prob. 9.6CPCh. 9 - Prob. 1MCCh. 9 - Prob. 2MCCh. 9 - Prob. 3MCCh. 9 - Prob. 4MC
Ch. 9 - Prob. 5MCCh. 9 - Prob. 6MCCh. 9 - Prob. 7MCCh. 9 - Prob. 8MCCh. 9 - Prob. 9MCCh. 9 - Prob. 10MCCh. 9 - Prob. 1TFCh. 9 - Prob. 2TFCh. 9 - Prob. 3TFCh. 9 - Prob. 4TFCh. 9 - Prob. 5TFCh. 9 - Prob. 1AWCh. 9 - Prob. 2AWCh. 9 - Prob. 3AWCh. 9 - What algorithm does the following pseudocode...Ch. 9 - Prob. 1SACh. 9 - Prob. 2SACh. 9 - Prob. 3SACh. 9 - Prob. 4SACh. 9 - Prob. 5SACh. 9 - Why is the selection sort more efficient than the...Ch. 9 - Prob. 7SACh. 9 - Prob. 8SACh. 9 - Assume the following main module is in a program...Ch. 9 - Prob. 1PECh. 9 - Sorted Names Design a program that allows the user...Ch. 9 - Rainfall Program Modification Recall that...Ch. 9 - Name Search Modify the Sorted Names program that...Ch. 9 - Charge Account Validation Recall that Programming...Ch. 9 - Prob. 7PECh. 9 - Sorting Benchmarks Modify the modules presented in...
Knowledge Booster
Learn more about
Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, computer-science and related others by exploring similar questions and additional content below.Similar questions
- C++ Code: This function will print out the information that has been previously read (using the function readData) in a format that aligns an individual's STR counts along a column. For example, the output for the above input will be: name Alice Bob Charlie ---------------------------------------- AGAT 5 3 6 AATG 2 7 1 TATC 8 4 5 This output uses text manipulators to left-align each name and counts within 10 characters. The row of dashes is set to 40 characters. /** * Computes the longest consecutive occurrences of several STRs in a DNA sequence * * @param sequence a DNA sequence of an individual * @param nameSTRs the STRs (eg. AGAT, AATG, TATC) * @returns the count of the longest consecutive occurrences of each STR in nameSTRs **/ vector<int> getSTRcounts(string& sequence, vector<string>& nameSTRs) For example, if the sequence is AACCCTGCGCGCGCGCGATCTATCTATCTATCTATCCAGCATTAGCTAGCATCAAGATAGATAGATGAATTTCGAAATGAATGAATGAATGAATGAATGAATG and the vector namesSTRs is…arrow_forwarddef main(): x = 1 y = 2 swap(x, y) print(x, y) def swap(s1, s2): temp = s1 s1 = s2 s2= temp main() Modify the code so that it actually swaps the values of x and y, without using the temp variable in the swap function.arrow_forwardDefine the term " null pointer " .arrow_forward
- In C language, write a program to convert an Infix Expression to Postfix and then evaluate. Do not use pointers.arrow_forwardIn C programming language: Write a function that takes 3 int arguments and returns the largest of the 3.arrow_forwardparameter list can also contain the data type of the output of function : true/false a function declared int addition (int a and b) is capable of returning one value back to the main loop : true/false main () is a void function: true / false the address returned by the reference pointer is always the same regardless of operating system: true/false a function declares as int addition (int a, int b) has a and b as output arguments : true/ falsearrow_forward
- In C language, write a program to input two integers x,y and add both the integers using pointers and display the result in the output. The assignment will be rejected if the numbers are added without the use of pointers.arrow_forwardStatic length data types vary from dynamic length data types by their intended use.arrow_forwardInstructions: In Basic C Language In the code editor, you are provided with a main function that asks the user for an integer input and passes this value to a function called, getFactorial() The getFactorial() function has the following description: Return type - int Name - getFactorial Parameters - one integer Description - returns the factorial of the passed integer Your implementation should be RECURSIVE and you should not use any loops Input #include<stdio.h> int getFactorial(int); int main(void) { int n; printf("Enter n: "); scanf("%d", &n); printf("Factorial of %d is %d", n, getFactorial(n)); return 0;} int getFactorial(int n) { // TODO: Implement this recursive function} Output should be: Enter n: 3 Factorial of 3 is 6arrow_forward
- What are the benefits of using decimal data types?arrow_forwardIn C++ Language using OOP, take an infix expression from user and convert to postfix and then evaluate. Do not use pointers and make sure the program is efficient and simple.arrow_forwardWhat are the potential design flaws here? A pointer can only hold one kind of variable in most programming languages.arrow_forward
arrow_back_ios
SEE MORE QUESTIONS
arrow_forward_ios
Recommended textbooks for you
- Systems ArchitectureComputer ScienceISBN:9781305080195Author:Stephen D. BurdPublisher:Cengage Learning
Systems Architecture
Computer Science
ISBN:9781305080195
Author:Stephen D. Burd
Publisher:Cengage Learning