ESSENTIALS OF GENETICS ALC & MOD MSTG/ET VP
1st Edition
ISBN: 9780134452890
Author: KLUG
Publisher: Pearson Education
expand_more
expand_more
format_list_bulleted
Concept explainers
Textbook Question
Chapter 9, Problem 33PDQ
Assume that you are interested in separating short (25–40 nucleotides) DNA molecules from a pool of longer molecules in the 900–1000
Expert Solution & Answer
Want to see the full answer?
Check out a sample textbook solutionStudents have asked these similar questions
What is the concentration of a DNA solution that absorbs 0.812 and 0.463 at 260 and 280 nm, respectively? Is the DNA solution considered to be good quality? Why or why not?
You have a 20 mg/ml of Ethidium bromide stock solution. You need to a final concentration of 2ug/ml into a Agarose solution to visualize DNA. What is the dilution factor?
Give typing answer with explanation and conclusion
A duplex DNA molecule contains a random sequence of the four nucleotides with equal proportions of each. What is the average spacing between consecutive occurrences of the sequence 5'-ATGC-3'? Between consecutive occurrences of the sequence 5'-TACGGC-3'?
Chapter 9 Solutions
ESSENTIALS OF GENETICS ALC & MOD MSTG/ET VP
Ch. 9 - CASE STUDY |Zigs and zags of the smallpox virus...Ch. 9 -
CASE STUDY | Zigs and zags of the smallpox...Ch. 9 - CASE STUDY | Zigs and zags of the smallpox...Ch. 9 - CASE STUDY | Zigs and zags of the smallpox virus...Ch. 9 -
HOW DO WE KNOW?
1. In this chapter, we have...Ch. 9 - Review the Chapter Concepts list on p. 160. Most...Ch. 9 - Discuss the reasons why proteins were generally...Ch. 9 -
4. Contrast the various contributions made to our...Ch. 9 - When Avery and his colleagues had obtained what...Ch. 9 - Why were 32P and 35S chosen in the Hershey–Chase...
Ch. 9 - Does the design of the Hershey-Chase experiment...Ch. 9 - What observations are consistent with the...Ch. 9 - What are the exceptions to the general rule that...Ch. 9 -
10. Draw the chemical structure of the three...Ch. 9 - How are the carbon and nitrogen atoms of the...Ch. 9 - Adenine may also be named 6–amino purine. How...Ch. 9 -
13. Draw the chemical structure of a dinucleotide...Ch. 9 - Describe the various characteristics of the...Ch. 9 - Prob. 15PDQCh. 9 - What might Watson and Crick have concluded, had...Ch. 9 - Prob. 17PDQCh. 9 - Prob. 18PDQCh. 9 - Prob. 19PDQCh. 9 - Prob. 20PDQCh. 9 - Prob. 21PDQCh. 9 - Prob. 22PDQCh. 9 -
23. Why is Tm related to base composition?
Ch. 9 - What is the chemical basis of molecular...Ch. 9 - What did the Watson–Crick model suggest about the...Ch. 9 - A genetics student was asked to draw the chemical...Ch. 9 - Prob. 27PDQCh. 9 -
28. One of the most common spontaneous lesions...Ch. 9 - Prob. 29PDQCh. 9 - Prob. 30PDQCh. 9 - Prob. 31PDQCh. 9 -
32. During electrophoresis, DNA molecules can...Ch. 9 - Assume that you are interested in separating short...
Knowledge Booster
Learn more about
Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.Similar questions
- If DNA concentration is 2 grams, what would be the molar concentration of human DNA in a human cell?arrow_forwardHow much buffer would you need to dilute a stock solution of DNA that is at a concentration of 150ug/ml to a final concentration of 8 ng/uL in 25 ml?arrow_forwardIF A DOUBLE-STRAND DNA SAMPLE WAS COMPOSED OF 10 PERCENT THYMINE, WHAT WOULD BE THE PERCENTAGE OF GUANINE?arrow_forward
- Assume that the molar percentage of thymine in a double stranded DNA is 20. What are the percentages of the four bases (G, C, T, A)? b. The base content of a sample of DNA is as follows: A=31% G=31% T=19% C=19%. What conclusion can be drawn from this information?arrow_forwardThe Tm of a DNA strand can be calculated by hand using the formula: (2 ℃)(?????? ?? ? + ?) + (4 ℃)(?????? ?? ? + ?) = ??℃ Using this formular, calculate the Tm for the following DNA sequence: [CTTTCACAGCCACTATCCAGCGGTAC] Note: This formula has several limitations and is not useful for sequences longer than 14 bp. Use the Internet search to find an online Tm calculator. Use this calculator to find the Tm of the above sequence. Using information from your search, identify three factors that can affect the Tm.arrow_forwardIf a double stranded DNA HAS 20 PERCENT OF CYTOSINE, calculate the percent of adenine of adenine in the DNA?arrow_forward
- The base composition of one of the DNA chains of a DNA double helix contains 18 mol-%A, 35 mol-%T, 26 mol-%C, and 21 mol-%G (a) What is the base composition of the complementary DNA chain? (b) Is the total amount of purine bases equal to the total amount of pyrimidine bases for the DNA double helix?arrow_forwardWhich one of these facts would NOT be needed in order to determine the correct base sequence from the image of DNA in the question above? Adenine and guanine are purines with a two-ring chemical structure. Cytosine and thymine are pyrimidines with a one-ring chemical structure. Adenine pairs only with thymine using two hydrogen-bonds. Cytosine pairs only with guanine using three hydrogen-bonds. All of the facts above are needed.arrow_forwardIf DNA concentration is 2 grams, what would be the molar concentration of human DNAin a human cell?arrow_forward
- In standard agarose gels used for the analysis of DNA, linear DNA fragments are separated on the basis of their... a) Size b) Charge c) Buoyancy d) Color e) Smellarrow_forwardAssuming the average weight of a deoxynucleotide monophosphate (dNMP) is 327.0 g/mol, how many picomoles of DNA are present in 500ng of a 1000bp DNA fragment?arrow_forwardWhat are the qualities of an appropriate sequence in DNA chromatogram? Why?arrow_forward
arrow_back_ios
SEE MORE QUESTIONS
arrow_forward_ios
Recommended textbooks for you
- Human Heredity: Principles and Issues (MindTap Co...BiologyISBN:9781305251052Author:Michael CummingsPublisher:Cengage Learning
Human Heredity: Principles and Issues (MindTap Co...
Biology
ISBN:9781305251052
Author:Michael Cummings
Publisher:Cengage Learning
QCE Biology: Introduction to Gene Expression; Author: Atomi;https://www.youtube.com/watch?v=a7hydUtCIJk;License: Standard YouTube License, CC-BY