Starting Out With C++: From Control Structures Through Objects, Brief Version Plus Mylab Programming With Pearson Etext -- Access Card Package (9th Edition)
9th Edition
ISBN: 9780135188651
Author: Tony Gaddis
Publisher: PEARSON
expand_more
expand_more
format_list_bulleted
Concept explainers
Expert Solution & Answer
Chapter 9, Problem 46RQE
Explanation of Solution
Null pointer:
When the address of pointer is set to “0” or when a pointer variable does not hold any value, then it is called as null pointers.
Example:
Consider the below example, pointer variable of integer data type initialized as null pointer:
// Defin...
Expert Solution & Answer
Want to see the full answer?
Check out a sample textbook solutionStudents have asked these similar questions
Q- Write a program which defines three integer variables, var1, var2 and var3, & initializing them to the values 100, 200 & 300, it then prints out their addresses.
Subject: C++
(C PROGRAMMING ONLY)
DO NOT EDIT THE MAIN FUNCTION
4. Simplicity is Beautyby CodeChum Admin
In life, simplicity is beauty.
Let's try creating something so simple. Let's create a function that accepts the address of an integer and prints n number of asterisks out of it.
For example, if the value of the address passed is 5, then the output would be five asterisks in one line.
Instructions:
In the code editor, you are provided with a main() function that asks the user for an integer and passes the address of this integer to a function call of the simple() function.This simple() function hasn't been implemented yet so your task is just that, to implement it. This has the following description:Return type - voidName - simpleParameter - address of an integerDescription - prints a line of asterisksDO NOT EDIT THE MAIN FUNCTIONInput
1. An integer
Output
Enter n: 5*****
Numbers that are the same as the direction of reading when they are read backwards and straight are called Palindromic numbers. Write a C program that writes to the screen whether a number entered by the user is a palindromic number. The part that finds the palindromic number will be written as a function and the Pointer will be used. Example: 101,232,3663,8008, etc.
Chapter 9 Solutions
Starting Out With C++: From Control Structures Through Objects, Brief Version Plus Mylab Programming With Pearson Etext -- Access Card Package (9th Edition)
Ch. 9.5 - Prob. 9.1CPCh. 9.5 - Write the definition statement for a variable...Ch. 9.5 - List three uses of the symbol in C++.Ch. 9.5 - What is the output of the following code? int x =...Ch. 9.5 - Rewrite the following loop so it uses pointer...Ch. 9.5 - Prob. 9.6CPCh. 9.5 - Prob. 9.7CPCh. 9.5 - Is each of the following definitions valid or...Ch. 9.9 - Prob. 9.9CPCh. 9.9 - Give an example of the proper way to call the...
Ch. 9.9 - Complete the following program skeleton. When...Ch. 9.9 - Look at the following array definition: const int...Ch. 9.9 - Assume ip is a pointer to an int. Write a...Ch. 9.9 - Prob. 9.14CPCh. 9.9 - Prob. 9.15CPCh. 9.9 - Prob. 9.16CPCh. 9.9 - Prob. 9.17CPCh. 9 - What does the indirection operator do?Ch. 9 - Look at the following code. int x = 7; int iptr =...Ch. 9 - So far you have learned three different uses for...Ch. 9 - Prob. 4RQECh. 9 - Prob. 5RQECh. 9 - Prob. 6RQECh. 9 - What is the purpose of the new operator?Ch. 9 - What happens when a program uses the new operator...Ch. 9 - Prob. 9RQECh. 9 - Prob. 10RQECh. 9 - Prob. 11RQECh. 9 - Prob. 12RQECh. 9 - Each byte in memory is assigned a unique...Ch. 9 - The _________ operator can be used to determine a...Ch. 9 - Prob. 15RQECh. 9 - The ________ operator can be used to work with the...Ch. 9 - Array names can be used as ________, and vice...Ch. 9 - Prob. 18RQECh. 9 - The ________ operator is used to dynamically...Ch. 9 - Under older compilers, if the new operator cannot...Ch. 9 - Prob. 21RQECh. 9 - When a program is finished with a chunk of...Ch. 9 - You should only use pointers with delete that were...Ch. 9 - Prob. 24RQECh. 9 - Look at the following array definition: int...Ch. 9 - Prob. 26RQECh. 9 - Assume tempNumbers is a pointer that points to a...Ch. 9 - Look at the following function definition: void...Ch. 9 - Prob. 29RQECh. 9 - Prob. 30RQECh. 9 - Prob. 31RQECh. 9 - T F The operator is used to get the address of a...Ch. 9 - T F Pointer variables are designed to hold...Ch. 9 - T F The symbol is called the indirection...Ch. 9 - T F The operator dereferences a pointer.Ch. 9 - T F When the indirection operator is used with a...Ch. 9 - T F Array names cannot be dereferenced with the...Ch. 9 - Prob. 38RQECh. 9 - T F The address operator is not needed to assign...Ch. 9 - T F You can change the address that an array name...Ch. 9 - T F Any mathematical operation, including...Ch. 9 - T F Pointers may be compared using the relational...Ch. 9 - T F When used as function parameters, reference...Ch. 9 - T F The new operator dynamically allocates memory.Ch. 9 - T F A pointer variable that has not been...Ch. 9 - Prob. 46RQECh. 9 - T F In using a pointer with the delete operator,...Ch. 9 - Prob. 48RQECh. 9 - Prob. 49RQECh. 9 - int x, ptr = nullptr; ptr = x;Ch. 9 - Prob. 51RQECh. 9 - Prob. 52RQECh. 9 - Prob. 53RQECh. 9 - float level; int fptr = level;Ch. 9 - Prob. 55RQECh. 9 - Prob. 56RQECh. 9 - Prob. 57RQECh. 9 - Prob. 58RQECh. 9 - int pint = nullptr; pint = new int[100]; //...Ch. 9 - Prob. 60RQECh. 9 - Prob. 61RQECh. 9 - Prob. 62RQECh. 9 - Array Allocator Write a function that dynamically...Ch. 9 - Test Scores #1 Write a program that dynamically...Ch. 9 - Drop Lowest Score Modify Problem 2 above so the...Ch. 9 - Test Scores #2 Modify the program of Programming...Ch. 9 - Prob. 5PCCh. 9 - Case Study Modification #1 Modify Program 9-19...Ch. 9 - Case Study Modification #2 Modify Program 9-19...Ch. 9 - Mode Function In statistics, the mode of a set of...Ch. 9 - Median Function In statistics, when a set of...Ch. 9 - Reverse Array Write a function that accepts an int...Ch. 9 - Array Expander Write a function that accepts an...Ch. 9 - Element Shifter Write a function that accepts an...Ch. 9 - Movie Statistics Write a program that can be used...
Knowledge Booster
Learn more about
Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, computer-science and related others by exploring similar questions and additional content below.Similar questions
- C and D only. In this program, you are asked to write a program in assembly which works as a simple calculator.The program will get two integer numbers, and based on the requested operation, the result shouldbe shown to the user.a. The program should print a meaningful phrase for each input, and the result.i. “Enter the first number”ii. “Enter the second number”iii. “Enter the operation type”iv. “The result is”b. The user should enter 0, 1, and 2 to tell the program the types of operation add, sub, andmultiply, respectively.c. How many registers do you need to implement this program?d. What system calls do you need to write this program?arrow_forward(C PROGRAMMING ONLY) 1. Pointing Fingersby CodeChum Admin I am so mad at my brothers, they always point their fingers to me whenever mom gets angry ? Now that I'm knowledgeable about pointers, I'm going to point all of my 5 fingers to them. Let's see who's tough now! Instructions: In the code editor, you are provided with a main() function where the user is asked for 5 double numbers.Then, in lines 19 - 23, your task is to set the addresses of these numbers to each of the pointers. The address of the first number, a, should be assigned to the first pointer, the address of the second number, b, should be assigned to the second pointer, and so on.Input 1. First number 2. Second number 3. Third number 4. Fourth number 5. Fifth number Output Enter 1st number: 23.2Enter 2nd number: 10.01Enter 3rd number: 800Enter4th number: 24Enter 5th number: 2123.2 10.0 800.0 24.0 21.0arrow_forwardC++ Code: This function will print out the information that has been previously read (using the function readData) in a format that aligns an individual's STR counts along a column. For example, the output for the above input will be: name Alice Bob Charlie ---------------------------------------- AGAT 5 3 6 AATG 2 7 1 TATC 8 4 5 This output uses text manipulators to left-align each name and counts within 10 characters. The row of dashes is set to 40 characters. /** * Computes the longest consecutive occurrences of several STRs in a DNA sequence * * @param sequence a DNA sequence of an individual * @param nameSTRs the STRs (eg. AGAT, AATG, TATC) * @returns the count of the longest consecutive occurrences of each STR in nameSTRs **/ vector<int> getSTRcounts(string& sequence, vector<string>& nameSTRs) For example, if the sequence is AACCCTGCGCGCGCGCGATCTATCTATCTATCTATCCAGCATTAGCTAGCATCAAGATAGATAGATGAATTTCGAAATGAATGAATGAATGAATGAATGAATG and the vector namesSTRs is…arrow_forward
- C++ Assume num is an integer. Write statements that will create a variable that can point to an int and store the address of num in the variable.arrow_forward(C PROGRAMMING ONLY) 3. How Much Is The House?by CodeChum Admin There's this house I want to buy just right around the corner. I know its address but I don't know its value. Can you please help me determine it? Instructions: In the code editor, you are provided with an initial code which has main() function.In the main(), the user is asked for an integer input and then its address is assigned to a pointer variable (see line 9)Your task is to print the value of the pointer variable using the dereferencing operator.Input 1. An integer Output Enter n: 5Value of *ptr = 5arrow_forwardPROGRAM C Operation: Operation by CodeChum Admin You have been cordially invited to partake in Operation: Operation. Your mission, should you choose to accept it, is to take the two numbers and the operator given then perform the operation successfully. Instructions: Input one number (integer or decimal), an operator (+, -, *, /), and another number (integer or decimal). Again, since we're scanning a character, don't forget to add a space before the character's placeholder like this, " %c", so that it won't be the newline character that will be scanned for the operator. Print the result of the operation between the two numbers, up to 2 decimal places. Input 1. First number 2. Operator 3. Second number Output The first line will contain a message prompt to input the first number. The second line will contain a message prompt to input the operator. The third line will contain a message prompt to input the second number. The last line contains the result with 2…arrow_forward
- CODE FOR SINGLE-DIGIT CALCULATOR USING EMU8086 Write a program that would accept 2 single-digit numbers num1 and num2 (0-9) and an arithmetic operator (+, - , * and /). Perform arithmetic operations entered with num1 and num2. If the operator is invalid, display "Operation Error".arrow_forwardGenerate the Three Address Code for the following void main( ) {int a; a = 2 + a; Print(a); }arrow_forwardC++ OOP Write a program that does the following:• Prompts the user to input five decimal numbers.• Prints the five decimal numbers.• Converts each decimal number to the nearest integer.• Adds the five integers.• Prints the sum and average of the five integers.arrow_forward
arrow_back_ios
SEE MORE QUESTIONS
arrow_forward_ios
Recommended textbooks for you
- Systems ArchitectureComputer ScienceISBN:9781305080195Author:Stephen D. BurdPublisher:Cengage LearningC++ for Engineers and ScientistsComputer ScienceISBN:9781133187844Author:Bronson, Gary J.Publisher:Course Technology PtrC++ Programming: From Problem Analysis to Program...Computer ScienceISBN:9781337102087Author:D. S. MalikPublisher:Cengage Learning
- Programming Logic & Design ComprehensiveComputer ScienceISBN:9781337669405Author:FARRELLPublisher:CengageMicrosoft Visual C#Computer ScienceISBN:9781337102100Author:Joyce, Farrell.Publisher:Cengage Learning,
Systems Architecture
Computer Science
ISBN:9781305080195
Author:Stephen D. Burd
Publisher:Cengage Learning
C++ for Engineers and Scientists
Computer Science
ISBN:9781133187844
Author:Bronson, Gary J.
Publisher:Course Technology Ptr
C++ Programming: From Problem Analysis to Program...
Computer Science
ISBN:9781337102087
Author:D. S. Malik
Publisher:Cengage Learning
Programming Logic & Design Comprehensive
Computer Science
ISBN:9781337669405
Author:FARRELL
Publisher:Cengage
Microsoft Visual C#
Computer Science
ISBN:9781337102100
Author:Joyce, Farrell.
Publisher:Cengage Learning,