Concept explainers
If you were look up Gaucher disease on the
a. For each mutation, speculate about whether the acid
b. Thinking about the production or function of the acid
Want to see the full answer?
Check out a sample textbook solutionChapter B Solutions
Pearson eText Genetic Analysis: An Integrated Approach -- Instant Access (Pearson+)
- The genetic alteration responsible for sickle-cell anemia in humans involves: a transition mutation from A to G, substituting glutamic acid for valine in a-globin a transversion mutation from T to A, substituting valine for glutamic acid in b-globin a transition mutation from T to C, substituting valine for glutamic acid in b-globin a transversion mutation from G to C, substituting glutamic acid for valine in a-globin a frameshift mutation of one ATC codon, removing glutamic acid from b-globinarrow_forwardMad cow disease, or bovine spongiform encephalopathy, appears to be caused by a novel infectious agent: a protein that replicates by causing related proteins to modify their structure from a harmless shape to a dangerous one. These prions (short for “proteinaceous infectious particles”) also appear to be the cause of several other spongiform encephalopathy diseases, such as scrapie in sheep, and kuru and Creutzfeldt-Jakob disease in humans. Which of the following observations or experiments would not support the hypothesis that a prion causes spongiform encephalopathy? (a) The brains of many sheep with scrapie contain prion proteins, but the brains of most sheep without scrapie do not. (b) There is a high incidence of kuru in populations of people who consume brain tissue from prion-infected animals. (c) Coyotes that feed on cows with mad cow disease do not subsequently develop spongiform encephalopathy. (d) When introduced into sheep brain cells in culture, prions cause the normal…arrow_forwardGene mutations can be classified in two major ways:(1) hereditary or germline mutations that are inherited from a parent and are present throughout a person’s life in virtually every cell in the body.(2) acquired or somatic mutations that occur at some time during a person’s life and are present only in certain cells, not in every cell in the body.If there is no family history of a particular disease but a child has the disease then it may have arisen due to a(n) ________ mutation early during development. A) acquired B) inherited C) silent D) transitionarrow_forward
- A research group collaborating with the hospital extracted DNA from the peripheral blood leucocytes of the patient V.1, her sister V.2, her mother IV.1 and her father IV.2 with consent and ethical approval for experimental work involving human tissues. These specimens were used for sequencing studies to screen for causative variants in amyloid precursor protein (APP), presenilin-1 (PSEN1) and presenlin-2 (PSEN-2) genes. The outcome is shown in Fig. 2 below. APP IV.1 961 TACGGCGGATGTGGCGGCAACCGGAACAACTTTGACACAGAAGAGTACTGCATGGCCGTG V.2 961 TACGGCGGATGTGGCGGCAACCGGAACAACTTTGACACAGAAGAGTACTGCATGGCCGTG -Y--G--G--C--G--G--N--R--N--N--F--D--T--E--E--Y--C--M--A--V- Amino Acid IV.2 961 TACGGCGGATGTGGCGGCAACCGGAATAACTTTGACACAGAAGAGTACTGCATGGCCGTG 1020 TACGGCGGATGTGGCGGCAACCGGAATAACTTTGACACAGAAGAGTACTGCATGGCCGTG 1020 Amino Acid -YGGCGGNRN NFD TEEY C-M-A-V-340 V.1 961 PSEN-1 IV.1 361 V.2 361 Amino Acid PSEN-2 1020 1020 340 CATACCGACACTCTCCCCCACACACCCCTGCACTCAATTCTCAATCCTCCCATCATCATC 420…arrow_forwardThere are three different chitin synthase genes that control the chitin synthesis in Saccharomyces cerevisiae, namely CHS I, CHSII, and CHSIII. If a mutation occurs in each of these genes, what will happen to the S. cerevisiae?arrow_forwardWhich form of Retinoblastoma typically results in unilateral disease and exhibits 2-hit mutational kinetics?arrow_forward
- Below is a figure (here called Figure 1) from “Prognostic Significance of CpG Island Methylator Phenotype and Microsatellite Instability in Gastric Carcinoma,” by An et al., published in Clinical Cancer Research in 2005. The authors look at five microsatellite loci (BAT 25, BAT 26, D2S123, D5S346, and D17S250) in normal (N) and tumor (T) tissue from patients with Gastric Carcinoma. They amplify the loci by PCR and then instead of using standard agarose gel electrophoresis, they run the PCR products through capillary gel electrophoresis and detect bands as they pass a laser near the positive charge terminal. The x-axis in these plots is the time at which the band passed the laser (aka size of the PCR product) and the intensity of the peaks represents the amount of DNA in that band A. Which patient- 18, 30, or 1- shows the most microsatellite instability? Which patient shows the least? How do you know? B. In which repair pathway is it most likely that you will find the driver mutations…arrow_forwardA neutral mutation is, by definition, a mutation that does not result in the change of the encoded amino acid sequence of a gene. 1)True 2)Falsearrow_forwardDescribe how polymorphisms is found at 13910-C/T and 22018-G/A in the regulatory area of the lactase gene (LCT). And elaborate the mechanism for two polymorphisms causing mutation from 13910-C/T and 22018-G/A to 13910-C/C or 22018-G/G variants in lactase intolerance disorder. also, how LCT gene is corelated to lactase intolerance disorder?arrow_forward
- 1). In the absence of this enzyme, a substance called ceroid lipofuscin accumulates in lysosomes in the brain, resulting in seizures, blindness, decline in cognitive function and motor skills, dementia, and death by the late teens or early 20’s. The TPP1 gene is 6695 bp in length. Think about the characteristics of Batten disease, and then suggest an approach to gene therapy that might be effective for this specific genetic disorder. You may assume that your research team is working in the U.S. and your research is funded by a grant from the National Institutes of Health (NIH). Please EXCLUDE the use of CRISPR from consideration. A. Will you use germline or somatic cell gene therapy? Please NAME and DEFINE the form of gene therapy selected, then explain WHY this is the most appropriate choice.arrow_forward1). In the absence of this enzyme, a substance called ceroid lipofuscin accumulates in lysosomes in the brain, resulting in seizures, blindness, decline in cognitive function and motor skills, dementia, and death by the late teens or early 20’s. The TPP1 gene is 6695 bp in length. Think about the characteristics of Batten disease, and then suggest an approach to gene therapy that might be effective for this specific genetic disorder. You may assume that your research team is working in the U.S. and your research is funded by a grant from the National Institutes of Health (NIH). a) Hypothetically, what specific type of VECTOR will you use to perform your gene therapy? Please select from the following list of potential vectors: disabled retrovirus, adenovirus, adeno-associated virus (AAV), or herpes simplex virus (HSV), then give two reasons why this specific vector is the most appropriate for your gene therapy. Please explain why you were able to rule out the other potential…arrow_forward1). In the absence of this enzyme, a substance called ceroid lipofuscin accumulates in lysosomes in the brain, resulting in seizures, blindness, decline in cognitive function and motor skills, dementia, and death by the late teens or early 20’s. The TPP1 gene is 6695 bp in length. Think about the characteristics of Batten disease, and then suggest an approach to gene therapy that might be effective for this specific genetic disorder. You may assume that your research team is working in the U.S. and your research is funded by a grant from the National Institutes of Health (NIH). Other scientists have suggested that it might be possible to use CRISPR to treat this genetic disorder in affected individuals. (i) First, what is CRISPR? (BRIEFLY describe what it is and how it works). (ii) Briefly describe how CRISPR could be utilized in treating genetic conditions such as Batten disease.arrow_forward
- Human Anatomy & Physiology (11th Edition)BiologyISBN:9780134580999Author:Elaine N. Marieb, Katja N. HoehnPublisher:PEARSONBiology 2eBiologyISBN:9781947172517Author:Matthew Douglas, Jung Choi, Mary Ann ClarkPublisher:OpenStaxAnatomy & PhysiologyBiologyISBN:9781259398629Author:McKinley, Michael P., O'loughlin, Valerie Dean, Bidle, Theresa StouterPublisher:Mcgraw Hill Education,
- Molecular Biology of the Cell (Sixth Edition)BiologyISBN:9780815344322Author:Bruce Alberts, Alexander D. Johnson, Julian Lewis, David Morgan, Martin Raff, Keith Roberts, Peter WalterPublisher:W. W. Norton & CompanyLaboratory Manual For Human Anatomy & PhysiologyBiologyISBN:9781260159363Author:Martin, Terry R., Prentice-craver, CynthiaPublisher:McGraw-Hill Publishing Co.Inquiry Into Life (16th Edition)BiologyISBN:9781260231700Author:Sylvia S. Mader, Michael WindelspechtPublisher:McGraw Hill Education