Worksheet7-Protein

i struggled with my homework and i need help

8:52 Protein 1-10092015113603.pdf https:api.schoology.comv1attachment169963839... Name Class Date Section Protein Synthesis pages 148-153) 7-3 SECTION REVIEW In this section you studied the process of pro- tein synthesis. You learned that the informa- tion that DNA transfers to messenger RNA (MRNA) is in the form of a code. When the information is decoded, chains of amino acids, called polypeptides, are formed. Polypeptides During translation, each MRNA codon in turn make up proteins, which direct biochemical pathways and are responsible for cell structure and movement. The genetic code is determined by the arrangement of the nitrogenous bases in DNA and RNA. A code word in DNA consists of a group of three nucleotides. When transcribed into MRNA, each code word, or codon, desig- nates a specific amino acid that is to be placed in the polypeptide chain. More than one codon may code for a particular amíno acid. The MANA sequence AUG serves as an initiator, or "start," codon. Three other…

RNA Transcription, Translation, and Mutation Worksheet First, here is a strand of DNA. This strand contains both a gene and its promoter region. Circle the promoter region in blue, draw a yellow box around the TATA box, draw a green box around the start codon, and draw a red box around the stop codon: TATATATATTACGTTGCATACGCTCAACGGTCGAAACTGCATGGGCAC ATATATATAATGCAACGTATGCGAGTTGCCAGCTTTGACGTACCCG Now imagine this gene has been transcribed into RNA. What would that RNA strand look like? Before the above RNA strand can be translated, a few modifications must first take place (in eukaryotes). What are they? 1) 2) 3) Using a codon chart of your choice (one can be found here, or here) translate the above RNA transcript (assume no splicing took place). Write the three letter abbreviations for the amino acids in the image below: Now imagine that a mutation took place in the original strand of DNA (marked in red) TATATATATTACGTTGCATACCCTCAACGGTCGAAACTGCATG…

B Relates to the ribosome codon question please do ii ribosome coding questions

22

Please answer the following question, thank you!

uestion 12 of 30 > Attempt 2 5'-GGU-3',5'-AAG-3',5'-IAC-3',5'-UGU-3', and 5'-CAA-3'. Give all A series of tRNAs have the anticodons, possible codons with which each tRNA can pair. Consider the wobble rules listed in the table. First position of anticodon C G A U I Third position of codon G U or C U A or G A, U, or C 5'-GGU-3' 5'-AAG-3' 5'-IAC-3' 5'-UGU-3' 5'-CAA-3' 3'-UUU-5' 3'-GUU-5' 3'-UUC-5' 3'-GUG-5' 3'-UUG-5' Answer Bank 3'-ACA-5' 3'-AAA-5' 3'-CUG-5' 3'-GCA-5' 3'-CCA-5' 3'-ACG-5' 3'-UGU-5' 3'-CCC-5' 3'-UCA-5' 3'-AUG-5'

This answer is incorrect pls provide the right answer and explanation

15

Complete number five.. please explain

I need help with #28 And #34 thank you

15-2. Explain whether the following statements are true or false.Justify the false ones.A. Ribosomes are the cytoplasmic structures that duringProtein synthesis is linked by an mRNA moleculeforming polyribosomes.B. The Leu-His-Arg-Leu-Asp-Ala-Gln-Ser- Amino Acid SequenceLys-Leu-Ser-Ser is a signal sequence that directs proteinsinto the endoplasmic reticulum.C. All transport vesicles in the cell must have av-SNARE protein in its membrane.D. The transport vesicles carry protein and lipid to thecell surface.E. If the delivery or distribution of lysosomal proteinsprospects from the trans-Glogii network to endosomes areblock, lysosomal proteins would be secreted by pathwaysof constitutive secretion like those in Figure 15-28.F. Lysosomes digest only substances that have been takenby cells by endocytosis. 15.3 Many of the proteins produced in the reticulumendoplasmic changes such as the addition ofcarbohydrates (oligosaccharides). What is the function of thesesugars in such proteins? 15.4…

Please help asap encoded text form please not handwritten thank you

9

4

FALSE Unanswered a Save 58 What segments of the pre mRNA comprise the coding region? pre-mRNA 5' UTR Exon Intron Exon Intron Exon 3' UTR MRNA Select an answer and submit. For keyboard navigation, use the up/down arrow keys to select an answer. a 5'UTR-EXONS-INTRONS 3'UTR 5'UTR-EXONS-3'UTR 5'UTR-INTRONS-3'UTR P. EXONS a Save Unanswered 59 What is b? 3'

Choose the correct option for following three mcqs 7.The first step in the capping reaction is catalyzed by: Phosphatase Guanylyl transferase Methyl transferase Kinase None of the above   8.Which of the following statements about tRNAs is FALSE? They contain an anti-codon loop They contain several modified bases Their secondary structure looks like a cloverleaf They are generally less then 100 nucleotides in length They are synthesized by RNA polymerase-II   9.During protein synthesis _____ delivers the charged tRNA to the A-site. EF-Tu EF-G eIF-2 RF1 RF2

helpp, if u could do this one first please

Variant 1 Task 1 One single polypeptide chain  (120 amino acid residues) is produced for protein A in prokaryotic cell. N-terminal amino acid is alanine in the chain of this protein. How many moles of ATP and GTP will be in use for this polypeptide chain synthesis? What post-translational modifications may be for this protein? Task 2 It is known that ribozymes may be participators of translation pathway. Prove this fact.

Do not use Ai

Thank you, I need answers here.

Answer codon usage based on this description: You have isolated a new eukaryotic microorganism and want to determine the genetic code of its mitochondria. Here are the amino acids encoded after translation of two synthetic mRNAs using mitochondrial extracts from your eukaryote- in this experiment translation can start at any sequence position: RNA: Protein: Tyr-Met-Tyr-Met-Tyr-Met---- UAUAUAUAUAUAUAU--- UAAUAAUAAUAAUAA--- Asn-Asn-Asn-Asn-Asn---- Met-Met-Met-Met-Met---- Based on the results shown here, what can you conclude about the codons in this eukaryote? A. B. C. D. O A O C OD OB AUA Tyr Met Tyr Met UAU Met Tyr Met Tyr AAU Met Trp Asn UAA Asn Asn Asn Asn, STOP or Met Asn, STOP or Met

You continue to study the expression of the hexose kinase gene and capture the following electron micrograph of the gene being expressed. MRNA 1 20 ORI 40 60 TTCGAGCTCTCGTCGTCGAGATACGCGATGATATTACTGGIAATATĞGGGATGCACTATC 5' 3' AAGCTCGAGAGCAGCAGCTCTATGCGCTACTATAATGACCA'NTATAÇCCCTACGTGATAG CACTATC promoter RNA polymerase ribosome

Which statements are true? Explain why or why not.1 The consequences of errors in transcription areless severe than those of errors in DNA replication.2 Since introns are largely genetic “junk,” they do nothave to be removed precisely from the primary transcriptduring RNA splicing.3 Wobble pairing occurs between the first positionin the codon and the third position in the anticodon.4 During protein synthesis, the thermodynamics ofbase-pairing between tRNAs and mRNAs sets the upperlimit for the accuracy with which protein molecules aremade.5 Protein enzymes are thought to greatly outnum-ber ribozymes in modern cells because they can catalyzea much greater variety of reactions and all of them havefaster rates than any ribozyme.

34) What amino acid sequence is coded for by the following DNA coding strand? (Recall: the DNA template strand runs 5' to 3' and the mRNA strand runs antiparallel to the DNA template strand. Recall that DNA is translated with a start codon.) 5'-TTATGCGACCAGACCAGTTT-3' Coding strand