1107LWk9RameshA

Given the DNA sequence of the restriction enzyme:  gi|6329444|dbj|AB034757.1| Hynobius retardatus mRNA for larval beta-globin, complete cds GCAGAATCTGACTCAAGAAATCCCTCCTCACCCAACACCACCAGCAGCCATGGTTCACTGGACAGCAGAGGAGAAGGCAGCCATCAGCTCTGTGTGGAAGCAGGTGAACGTGGAGAGCGATGGACAGGAGGCCCTGGCCAGGTTGCTGATCGTCTACCCCTGGACCCAGAGATACTTCAGCTCTTTTGGGGACCTGTCGAGCCCAGCTGCCATTTGTGCCAACGCCAAGGTCCGTGCCCATGGCAAGAAGGTCCTGTCCGCCCTGGGAGCCGGCGCCAACCACCTGGATGACATCAAAGGCAACTTTGCTGATCTGAGCAAGCTTCACGCAGACACACTCCATGTGGACCCCAATAACTTCCTGCTCCTGGCAAACTGCCTGGTGATCGTCTTGGCCCGCAAGCTGGGAGCCGCCTTCAACCCTCAAGTCCATGCGGCCTGGGAGAAGTTCCTGGCCGTCTCCACCGCGGCTCTGTCCAGAAACTACCACTAGAGACTGGTCTTTGGGTTTAATTCTGTGAACGTCCCTGAGACAAATGATCTTTCAATGTGTAAACCTGTCATTACATCAATAAAGAGACATCTAACAAAAAAAAAAAAAAAAAAAAAAAAAA   Identify two blunt-end cutters Identify two sticky-end cutters. For each, Provide the sequence of the Restriction enzyme, Highlight using a specific color where the DNA sequence where the restriction enzyme will cut the DNA Indicate the…

I don't need explanations Just answer choices please. And Are the selected answers choices for 1-4 correct?

Complete the following problems. Restriction enzymes (REs), which cut D NA at specific sequences, are classic tools in molecular biology. Because of their specificity in cutting DNA, REs can be used to "map" DNA sequences by analyzing the fragments generated upon restriction digest, as in the example shown in Figure 1. Your task is to study the circular plasmid, pMBBS, through restriction digests. You subjected the pMBBS plasmid to complete digestion by different combinations of three REs (EcoRI, BamHI, and Xhol), and analyzed the results on an agarose gel, shown below. Using the data you can glean from this gel, answer the questions that follow. EcoRI BamHI Xhol *The same total amount of DNA was loaded in each lane. 1. What is the total size of the pMBBS plasmid in bp? Answer: bp + DNA size ladder 2. How many cut sites on the PMBBS plasmid does each RE have? EcoRI: BamHI: Xhol: 3000 bp 2500 bp -2000 bp -1500 bp 1200 bp 1000 bp 900 bp 800 bp 700 bp 600 bp 500 bp 400 bp 300 bp 200 bp…

Please answer asap and type your answer and do not copy from anywhere please NOTE*** double stranded complementary DNA I have determined is GTCATACCTAGGGTA with a palindromic site of CCTAGG and the enzyme BamHI that will cut the recognition site. In the double-stranded DNA you have determined, there is also another recognition site for common restriction enzymes. Which enzyme would cut your DNA at this other recognition site? (Hint: Remember that one recognition site can overlap with or be completely contained by the sequence containing another recognition site.) HindIII Sau3AI AluI BamHI

Please solve - no AI answers please. Please refers to image for all detail and explain answers please

After restriction enzymes cut, they contain unpaired bases. Type II restriction enzymes leave ends that may be 5' overhanging, 3' overhanging, or blunt.  In all cases each end is left with a 3' OH and a 5' phosphate.  All blunt ends, and any complementary overhanging ends may be re-ligated with T4 DNA ligase, as long as at least one 5'- phosphate is present.   In the tables below G^AATTC means that the end after cutting with enzyme will be: -----G      3' -----CTTAA  5' GTGCA^C means that the end will be:   -----GTGCA  3' -----C      5'     Which RE’s from table below have a 5’ overhang? Which ones have a 3’ Overhang?   AccI GT^CGAC BamHI G^GATCC     ClaI AT^CGAT NsiI ATGCA^T PstI CTGCA^G BglII A^GATCT TaqI T^CGA

Examine the DNA fragment sequence below. Your job is to design primers for PCR that would be able to amplify this DNA fragment. Design the primers so that they are 7 bases in length.  Don’t forget to indicate direction (polarity) of the primers. Also describe where the primer would bind (i.e. top or bottom strand, left or right side of the DNA strand). Please organize your response so that each primer, and associated information, is separated by at least one blank line  5’ - TCCACTTGCTGTGTAGCTAAATCATATAACAG3’ - AGGTGAACGACACATCGATTTAGTATATTGAC

Primer Designing:

Please don't provide handwriting solution

ersonal/eenongen_my_tnstate_edu/_layouts/15/doc.aspx?sourcedoc={a6b083c9-a226-4c31... ☆ Search (Option + Q) Review View Help Picture Editing A В ... During nucleic acid hybridization, the probe is labelled Question 1 options: for DNA stability to increase probe-test DNA binding to identify the location of probe and the test DNA binding for amplification Question 2 6. 9. 10 IV 13 14 Which of the following best describes the trait in the pedigree? Question 2 options: X-linked dominant X-linked recessive autosomal domiant autosomal recessive ON

U have the plasmid pUC18/19, which is a circular plasmid that consists of 2686 bp. What would the number of and length of the fragments be if you cut the plasmid with the following restriction enzymes or combination of enzymes? Give a schematic representation of the digestions. PscI & GsuI ______________________________________________________________ ScaI, PdmI & BsaXI ______________________________________________________________ ScaI, SspI & EheI ______________________________________________________________

Please don't provide handwritten solution

Please explain

Please answer both Part a. The plasmid you used as a template in your positive control for your PCR is 3300 bp in size. Why is the PCR product only 650 bp long? b. You using PCR to check for the presence of the GFP gene, however the thermocyder (machine that through temperatures) has been misprogrammed and tge annealing temperature is set to 43c (low for your primers) Explain what you would expect to see on your gel and why?

please help

Please explain in detail....

Resriction Enzyme Worksheet #1

Assume complete digestion of a single linear piece of DNA digested (cut) with EcoRI and Hindill. Assume complete digestion of the plasmid digested with Eco and HindIll. What comes out of the plasmid when you digest with EcoRl and Hindill? What could ligate into the plasmid during ligation! Need help answering these questions

Please answer this asap. Thanks,   You have discovered a new plasmid RK21 in a unique bacterial community. As a first step towardunderstanding this plasmid, you digest the plasmid with three restriction enzymes: SspI, XhoI andSmaI. You run the digested plasmid DNA on an agarose gel, along with an uncut sample of theRK21 plasmid DNA as a control.Unfortunately you forget to load a DNA ladder, and obtain the following results. Assumecomplete digestion of all samples or all the digests worked completely

Answer the auestions below. Thank you.

I. You wish to perform an electrophoretic resolution of your restriction enzyme–digested DNA. The sizes of the expected fragments range from 100 to 500 bp. You discover two agarose gels polymerizing on the bench. One is 0.5% agarose; the other is 2% agarose. Which one might you use to resolve your fragments? I. What does it mean to “denature” a protein and why is this important for SDS PAGE? II. Describe how you denatured the proteins you used for SDS-PAGE. III. Describe the roles of the primary Antibody and the secondary Antibody during an ELISA test. IV. After the addition of the secondary Antibody, how did you determine which wells contain the Antigen bound to primary Antibody bound to secondary Antibody?

Solve the problem clearly and thoroughly, using the image for all relevant information. Once done, double-check the solution to ensure accuracy. On occasions I receive incorrect answers!. Please by considering that, check your working out and then finalise!.

Please help with all parts of this problem. Double check your answers.

Decide on two restriction sites that you can use to clone this into pL4440’s MCS. Identify their sequence and explain why. Tip: The plasmid map is showed below, details of restriction site sequences can be found at https://enzymefinder.neb.com/#!#nebheader

please help me with this question. As this is a non-directional cloning, recombinant plasmids can contain an insert ligated into the vector in two different orientations. Provide two diagrams to illustrate the two potential recombinant plasmids, with the inserts ligated in opposite orientations. Include all RE sites and distances between sites on the diagram.

Need help, please. Please refer to the images attached. The questions are in the second image attached asking for basepair lengths. The first image is just for information.

A cloned Bam HI DNA fragment, 3.0 kb long, was isolated in preparation for sequence determination. First, a map of restriction endonuclease cleavage sites had to be prepared. Cleavage by each of the indicated enzymes generated fragments of the sizes shown on the three agarose electrophoresis gel figures below; the gels are running from top to bottom. On the diagram below those, show the relative positions of EcoR I and Hpa II cleavage sites and the distances (in kb) between them. Explain your reasoning – is your placement of the cleavage sites the only one that will work?

please explain this

Decide on two restriction sites that you can use to clone this into pL4440’s MCS. Identify their sequence. Tip: The plasmid map is in Figure 3, details of restriction site sequences can be found at https://enzymefinder.neb.com/#!#nebheader