Q: Describe Three Eukaryotic RNA Polymerases CatalyzeFormation of Different RNAs.
A: In eukaryotes transcription is achieved by three different types of RNA polymerase ,RNA (1-3). RNA…
Q: 7) Describe in detail the mechanism by which the major spliceosome removes introns from pre-mRNA…
A: Spliceosome is a complex small nuclear RNA protein molecule also called snRNA that helps to remove…
Q: 1. For each of the following, explain how eukaryotic transcriptional initiation would be affected.…
A: According to bartleby expert guidelines, when multiple questions are posted we are allowed to answer…
Q: 5. Small interfering RNAS, microRNAS and Piwi-interacting RNAS are all classes of small RNA…
A: RNA can be defined as a nucleic acid present in all living cells. It is similar to DNA, but differs…
Q: 1. What sequences form most of the human genome? What is their significance in the expression of…
A: The Alu sequence is known form most of the human genome, it is the most frequent sequence and occur…
Q: What are the 3 ways in which sRNAs regulate the translation of mRNAs?
A: Gene regulation involves the expression of certain genes at a time out of all the genes present in…
Q: 4. What is the use of miRNAs in the cell? Please discuss the effect of a mutant Argonaute protein on…
A: RNA (ribonucleic acid) is a polymer of nucleotides that is composed of pentose sugar, a nitrogen…
Q: 2. Distinguish among inducible, repressible, and constitutive gene operons.
A: An operon is a functional unit of genomic DNA that comprises a collection of genes that are all…
Q: 1a) What amino acid would be coded for by the codon 5'AGG3'?
A: Codons are the trinucleotide sequences of DNA or RNA that specifies amino acids. There are 20 amino…
Q: 1. why does the genome contain so many more genes for rRNA than mRNA? 2. why is it effective for a…
A: Since you have asked multiple questions, we will solve the first question for you. If you want any…
Q: 1. You wish to introduce a eukaryotic gene into a prokaryote. Describe two aspects of the gene that…
A: Please follow step 2 for detailed explanation.
Q: Compare the control of gene regulation in eukaryotes and prokaryotes in terms of: a. transcription…
A: Prokaryotes and eukaryotes change their Gene articulation with respect to their environmental…
Q: 1. What is the production of RNA called and what is the enzyme that catalyzes the process? 2. What…
A: “Since you have posted a question with multiple sub-parts, we will solve the first three subparts…
Q: All of the following occur when the amino acids of two tRNA molecules are joined, except. a. The…
A: DNA replication, transcription, and translation are the molecular processes that are responsible for…
Q: What is a consensus sequence? What are the components of RNA polymerase and what are their functions
A: RNA polymerase is an enzyme that catalyzes the synthesis of RNA from RNA template.
Q: 10. List three examples of stop codons. a) .. b) .... c)
A: Genetic code It is a dictionary that corresponds with sequence of nucleotides and sequence of amino…
Q: 3. Explain the three stages of transcription in Eukaryotic cell. Identify all enzymes used with…
A: The transcription is the process by which mRNA is produced from the DNA template and during the…
Q: The two factors that bind directly to the DNA at Pacific sequences are TFIID and TFIIB- in general…
A: It is found in the eukaryotic transcription processing system.
Q: 5. What is the correct reading frame for the following mRNA? MRNA 5' GGCACUUAUGCGAUGCCUUGAGUGACCAU…
A: mRNA is made from DNA by the process of Transcription.
Q: 5) The bacterial Lac operon is an example of transcriptional regulation. What are the major…
A: Using an example of Escherichia coli for the bacterial lac operon. Escherichia coli is a…
Q: 1. What term is referred to the process of removing large portions of the RNA primary transcript…
A: Introduction :- Splicing is the process of excising introns (noncoding sections of genes) from…
Q: Given the DNA sequence 5′-AUG GCU AGA GUU GAA AAA-3′, which of these sequences represents a silent…
A: According to bartleby expert guideline we are allowed to answer only one question. Kindly repost the…
Q: There are 3 RNA polymerases in eukaryotes. Write a sentence about the function of each. Which is…
A: RNA polymerase enzyme synthesizes RNA from template of DNA.
Q: 4. A protein is found with the sequence Met-Thr-Tp-Phe-Lys-Cys-Arg-His-Pro-Gly, A mutant is found…
A: Mutations are change in the nucleotide sequence which results in abnormalities in the protein…
Q: 4. A mutant strain of E. coli produces B-galactosidase in the presence and the absence of lactose.…
A: An operon is defined as a set of structural genes regulated by a common promoter in bacteria.
Q: 1 How Are Genes Transcribed in Bacteria?
A: Bacteria transcription is considered as the process, in which newly synthesized RNA (mRNA) is…
Q: 2. What is attenuation and what is its significance in prokaryotic gene regulation? Explain…
A: Gene expression is defined as a process which is used by cells to convert the instructions coded in…
Q: 2. There is no sigma factor on the RNA polymerase II. How does RNA polymerase Il know where to start…
A: Usually in Eukaryotic transcription initiation the transcription factor identifies promoter and then…
Q: the two factors that bind directly to the DNA at specific sequences are TFID and TFIIB, in genreal…
A: Transcription is the process by which the information in a strand of DNA is copied into a new…
Q: 1. What are the main elements of the lac operon and their functions?
A: NOTE- Since you have posted multiple questions So we will be solving the first question for you. As…
Q: 6. Indicate whether each of the following events occurs when tryptophan is high or when tryptophan…
A: Introduction Gene Regulation: Expression of gene is highly regulated in both prokaryotes as well as…
Q: 2. Given the mRNA for a protein: 5'-CCGAACGAUGGGCUAUCCCUAACCGUUU --- 3' Write the amino acid…
A: We'll answer the first question since the exact one is not specified. Please submit a new question…
Q: What molecule do microRNAs bind to, and what is the direct result of this binding? A. microRNAs…
A: MicroRNAs are non-coding, single stranded RNA molecules. They are composed of 20-22 nucleotides and…
Q: 1) List 5 factors involved in the process of either initation or elongation of translation
A: Translation is the process by which the genetic code contained within an mRNA is decoded to produce…
Q: . What are the functions of the following list of RNAs; a. mRNA b. rRNA c. snoRNA d. snRNA e. tRNA…
A: RNA is a single strand of ribonucleic acid which is made up of polynucleotide chain. A nucleotide…
Q: 1- How does the sigma factor control whether it can start transcription together to give way to RNA…
A: Transcription is the process where one strand of DNA is transcribed into RNA is known as antisense…
Q: What anticodon would a suppressor tRNA have to have to suppress a 5'UAA3' stop codon?
A: A mutation in the gene that changes its anticodon loop for a tRNA molecule can "suppress" nonsense…
Q: (D) An experiment by Gobind Har Khorana and his colleagues used a synthetic RNA sequences consisting…
A: mRNA: Messenger RNA It is a type of RNA that plays a very important role in protein synthesis…
Q: Describe 2 ways RNA is processed after transcription
A: RNA processing after transcription is discussed below.
Q: 9. The following sequence is a wild-type bacterial gene that encodes a short protein. The sequence…
A: A) Lower Strand will act as template strand. B)5' ACUUCGAUAUGUCUAAAAUA 3'
Q: 3. What is meant by the term histone code? With regard to gene regulation, what is the proposed role…
A: DNA is the genetic material in most living organisms. It is the information hub of the cell that…
Q: What does miRNA stand for? Please explain its biogenesis
A: RNA (ribonucleic acid ) is biological macromolecule which play important role in manufacturing of…
Q: The Shine Dalgarno sequence is ____________. located in the 50S subunit of ribosome. located on…
A: The correct option is (C) a sequence upstream of the AUG initiation codon on mRNA.
Q: 5'.GTCTCTTGACATTG... 3' What is the MRNA sequence transcribed from this sequence (assume the…
A: Ans ) Always Guanine codes for cysteine only .. That is G-C Given.…
Q: 4. a) Explain what is meant by the term "alternative splicing" b) what does it help to explain?
A: The process by which introns, the noncoding regions of genes, are excised out of the primary…
Q: 12. The following codons and the amino acids they encode is as follows: AUG = Met %3D UUU, UUC = Phe…
A: ANSWER;- a) The sequence of amino acids in the following structure Met-Phe-Leu-Ser-Thr-Pro b)(i) DNA…
Q: double-stranded RNA
A: ribonuclease III family Enzymes from the ribonuclease III family bind and cleave…
Q: 2) a) What would be the effect of introducing a -1 frameshift mutation into the 23S rRNA gene? .: b)…
A: A frameshift mutation is one in which a nucleotide is inserted or deleted in such a way that the…
Q: 4. Compare the control of gene regulation in eukaryotes and prokaryotes in terms of: a.…
A: Note: as per the guidelines, we are authorized to answer one question at a time. Please post the…
Gene Interactions
When the expression of a single trait is influenced by two or more different non-allelic genes, it is termed as genetic interaction. According to Mendel's law of inheritance, each gene functions in its own way and does not depend on the function of another gene, i.e., a single gene controls each of seven characteristics considered, but the complex contribution of many different genes determine many traits of an organism.
Gene Expression
Gene expression is a process by which the instructions present in deoxyribonucleic acid (DNA) are converted into useful molecules such as proteins, and functional messenger ribonucleic (mRNA) molecules in the case of non-protein-coding genes.
Step by step
Solved in 2 steps
- Which of the following statements about RNA processing in eukaryotes is INCORRECT? A. The excision of introns from pre-mRNA is the only modification required to produce a mature mRNA. B. A protein/RNA complex is used to remove introns from the pre-mRNA. C. A poly A tail is added on to the 3′ end of the mRNA. D. A 7-methylguanosine cap is added on to the 5′end of the mRNA. E. Modification occurs in the nucleus.1. What term is referred to the process of removing large portions of the RNA primary transcript molecules and reconnecting the remaining portions? A. Exon splicing B. UTR splicing C. Intron splicing D. RNA splicing 2. Which of the following does not involved in the proofreading and repair of DNA? A. Isomerase B. Ligase C. DNA Polymerase I D. Nuclease1. Which of the following statements about mRNA is correct?a. Eukaryotic mRNA is generally polycistronic while prokaryotic mRNA is monocistronic.b. Both prokaryotic and eukaryotic RNA is polycistronic.c. Both prokaryotic and eukaryotic RNA is monocistronic.d. Eukaryotic mRNA is generally monocistronic while prokaryotic mRNA is polycistronic. 2. Which of the following statements about leading and lagging strand synthesis is correct?a. The lagging strand can only be synthesized once the leading strand has been completedb. Lagging strand is synthesized is continuously while leading strand is synthesized fragment by fragment.c. Leading strand is synthesized is continuously while lagging strand is synthesized fragment by fragment.d. Okazaki fragments are used to synthesize the leading and lagging strands of DNA. 3. An intron of a gene had a G to T mutation on the 3’ splice site. What will happento this intron?a. The intron will not be spliced out but will not be recognized in the ribosome…
- 1. Which of the following statements about the flow of genetic information is correct?A. Translation occurs prior to transcription during protein synthesis.B. During translation, the DNA template is converted to amino acids by the ribosomes.C. During transcription, the DNA template is converted to an RNA molecule by the enzyme RNA polymerase.D. Eukaryotic mRNA needs to be transported to the cytoplasm before the protein products are synthesized. 2. What is the main difference in the cell wall composition between eukaryotes and prokaryotes?A. Eukaryotic cell wall is mainly composed on sugar molecules while prokaryotic cell wall has both sugars and amino acids.B. Prokaryotic cell wall is mainly composed on sugar and lipid molecules while eukaryotic cell wall has both sugars and amino acidsC. Prokaryotic cell wall is mainly composed on sugar molecules while eukaryotic cell wall has both sugars and amino acids.D. Eukaryotic cell wall is mainly composed on sugar and lipid molecules while…1. What are the functions of the following list of RNAs; a. mRNA b. rRNA c. snoRNA d. snRNA e. tRNA f. scaRNA g. miRNA h. siRNA1.- Outline the general process of transcription (dna->rna) include a diagram a) include the basic enzymes involved and a description of their actions b) what is the product of transcription c)what will the cell do with the product d)where does the transcription take place in prokaryotic cell
- 1. Write a short note on transcription. What is TFBS? What is the role of RNA polymerase?2. What do you understand by cis & trans regulations? Describe. Answer all the part in detail...1. If a mutation occurs in a coding region a. it will cause a change or changes in the normal (wild type) amino acid sequence. b. the protein may not form correctly and as a result does not perform the intended function. c. the type of mutation can be a missense mutation if there is some or limited protein function. d. the type of mutation can be a nonsense mutation if there is no protein function. e. all of the above 2. If a mutation occurs in a non-coding region: a. it will cause no change in the normal (wild type) amino acid sequence. b. the protein is unaffected and still functions correctly. c. the type of mutation is called a silent mutation. d. the protein may not form correctly and as a result does not perform the intended function. e. all of the above1. What is the central dogma? What are the compounds involved in this process? (Keywords: transcription of DNA to RNA, translation of RNA to proteins; gene expression)
- 1) Below are some events that occur in the process of translating mRNA into a protein in a bacterial cell. Pick the best order of events. EF-G–GTP binds to the tRNA in the A site and causes the tRNA to advance to the P site.- The rRNA in the ribosomal 30S subunit base-pairs with the Shine-Dalgarno sequence in the mRNA.- Peptide bond forms between the growing amino acid chain in the P site and the new amino acid in the A site.- IF-3 binds in the E site.- RRF binds in the A site.- RF-1 or -2 binds in the A site.- Ribosomal complex dissociates.- Peptide chain dissociates from final tRNA.- fMET tRNA binds to the start codon in the mRNA.- RF-3–GTP causes displacement of RF-1 or -2 and its exit from the ribosome.- EF-G–GTP binds to the A site and causes RRF to shift to the P site.- A conformational change in the 30S subunit allows the 50S subunit to bind, forming the 70S ribosome. Step 1, 2, 3, 4 ,5 ,6 , 7, 8, 9, 10, 11, 121. Which of the following repair mechanisms can lead to frameshift mutations? a. Nonhomologous end-joining b. Nucleotide excision repair c. Mismatch repair d. Homologous recombination 2. In eukaryotes, what must be formed before translation is initiated? a. The binding of 30s ribosomes with IF1, IF3, mRNA, and fmet-tRNAf b. The binding of 40s ribosomes with eIF1, eIF3, mRNA, and fmet-tRNAf c. The binding of 50s ribosomes with IF1, IF3, mRNA, and fmet-tRNAf d. The circularization of mRNA and subsequent binding with the complex made up of 40s ribosomes with eIF1, eIF3, and met-tRNAi. 3. Which of the following eukaryotic transcription initiation factors is correctly paired with their function? a. TFIID recruits RNAPII to the promoter b. TFIIA binds to the TATA box. c. TFIIF kicks out the inhibitory protein in TFIID. d. TFIIH melts the DNA to open the transcription bubble.1) Where in the heck did Class I transposons originate? a DNA mutations. b Bacteria. c Prophages. d Retroviruses. 2) What do you think about humans only having about 22,500 genes but we contain about 100,000 proteins?! a The production of quaternary shape in proteins can contribute to protein variation. b That's the work of the spliceosome! c Post-translation modifications in the Golgi Apparatus are responsible for some of that. d All the answers are correct.
