1>E%# m12Searchentral dogma (1) - WordReviewViewHelpb 13 ^、,三,出令1 Normal 1 No Spac. Heading 1AaBbCcI AaBbCcI AaBbC AABBCCD AaB AaBbCcDHeading 2TitleSubtitleA Sel4.ParagraphStylesEditin5.7.3.9. The following sequence is a wild-type bacterial gene that encodes a short protein. The sequencegiven is from the point where transcription starts (called "+1") to the point where transcription ends.Transcription goes left to right.5'-ACTTCGATATGTCTAAAATATCGATCGATCTGTGGGGCCTAGCTAGCTAACCAGAGACGCTACCG-33'-TGAAGCTATACAGATTTTATAGCTAGCTAGACACCCCGGATCGATCGATTGGTCTCTGCGATGGC-5'(a) Which strand (the upper or the lower) is used as the template in transcription?(b) Write out the first 20 bases of the RNA transcribed from this wild-type gene. Make sure to label the 5'and 3' ends of your molecule.(c) Write out the amino acid sequence of any protein that is encoded by this wild-type gene. Make sure tolabel the N and C termini of your molecule.The following sequence is a mutant version of the above gene that is present in a mutant bacterial strain. Thenature of the mutation is that the base-pair bolded above in the wild-type sequence has been deleted. Thesequence given is from the point where transcription starts to the point where transcription ends.5'-ACTTCGATATGTCTAAAATACGATCGATCTGTGGGGCCTAGCTAGCTAACCAGAGACGCTACCG-3'3'-TGAAGCTATACAGATTTTATGCTAGCTAGACACCCCGGATCGATCGATTGGTCTCTGCGATGGC-5(e) Write out the amino acid sequence of any protein that is encoded by this mutated gene. Make sure tolabel the N and C termini of your molecule.(f) What is the nature of the mutation and how does it affect the protein?estigateDFocusF2F4F5F7F8F10F12PrtScrInsert%244.C23V2.3.5.9.

A) Lower Strand will act as template strand. B)5' ACUUCGAUAUGUCUAAAAUA 3'

Answered: 9. The following sequence is a…

Biochemistry

6th Edition

ISBN:9781305577206

Author:Reginald H. Garrett, Charles M. Grisham

Publisher:Reginald H. Garrett, Charles M. Grisham

Chapter17: Metabolism: An Overview

Section: Chapter Questions

Problem 13P: What Art the Features of the Series of -omes? Define the following terms: a. Genome b. Transcriptome...

See similar textbooks

Similar questions

Diamond–Blackfan anemia (DBA) is a rare, dominant geneticdisorder characterized by bone marrow malfunction, birthdefects, and a predisposition to certain cancers. Infants withDBA usually develop anemia in the first year of life, have lower thannormal production of red blood cells in their bone marrow, and havea high risk of developing leukemia and bone cancer. At the molecularlevel, DBA is caused by mutations in any one of 10 genes thatencode ribosomal proteins. The first-line therapy for DBA is steroidtreatment, but more than half of affected children develop resistanceto the drugs and in these cases, treatment is halted. DBA canbe treated successfully with bone marrow or stem cell transplantsfrom donors with closely matching immune system markers. Transplantsfrom unrelated donors have significant levels of complicationsand mortality. A couple with a child affected with DBA undergoes in vitro fertilization (IVF) and genetic testing of the resulting embryos to ensure that the embryos…
Diamond–Blackfan anemia (DBA) is a rare, dominantgenetic disorder characterized by bone marrow malfunction,birth defects, and a predisposition to certaincancers. Infants with DBA usually develop anemia in the firstyear of life, have lower than normal production of red blood cellsin their bone marrow, and have a high risk of developing leukemiaand bone cancer. At the molecular level, DBA is causedby mutations in any one of 10 genes that encode ribosomalproteins. The first-line therapy for DBA is steroid treatment,but more than half of affected children develop resistance tothe drugs and in these cases, treatment is halted. DBA can betreated successfully with bone marrow or stem cell transplantsfrom donors with closely matching immune system markers.Transplants from unrelated donors have significant levels ofcomplications and mortality. While a stem cell transplant from an unaffected donor is currentlythe only cure for DBA, genome-editing technologies mayone day enable the correction of…
Diamond–Blackfan anemia (DBA) is a rare, dominantgenetic disorder characterized by bone marrow malfunction,birth defects, and a predisposition to certaincancers. Infants with DBA usually develop anemia in the firstyear of life, have lower than normal production of red blood cellsin their bone marrow, and have a high risk of developing leukemiaand bone cancer. At the molecular level, DBA is causedby mutations in any one of 10 genes that encode ribosomalproteins. The first-line therapy for DBA is steroid treatment,but more than half of affected children develop resistance tothe drugs and in these cases, treatment is halted. DBA can betreated successfully with bone marrow or stem cell transplantsfrom donors with closely matching immune system markers.Transplants from unrelated donors have significant levels ofcomplications and mortality. Given that a faulty ribosomal protein is the culprit and causesDBA, discuss the possible role of normal ribosomal proteins.Why might bone marrow cells be…
Which of the following set(s) of primers a–d couldyou use to amplify the following target DNA sequence, which is part of the last protein-coding exonof the CFTR gene?5′ GGCTAAGATCTGAATTTTCCGAG ... TTGGGCAATAATGTAGCGCCTT 3′3′ CCGATTCTAGACTTAAAAGGCTC ... AACCCGTTATTACATCGCGGAA 5′a. 5′ GGAAAATTCAGATCTTAG 3′;5′ TGGGCAATAATGTAGCGC 3′b. 5′ GCTAAGATCTGAATTTTC 3′;3′ ACCCGTTATTACATCGCG 5′c. 3′ GATTCTAGACTTAAAGGC 5′;3′ ACCCGTTATTACATCGCG 5′d. 5′ GCTAAGATCTGAATTTTC 3′;5′ TGGGCAATAATGTAGCGC 3′
2. Null mutations are valuable genetic resources becausethey allow a researcher to determine what happens to anorganism in the complete absence of a particular protein. However, it is often not a trivial matter to determinewhether a mutation represents the null state of the gene.a. Geneticists sometimes use the following test forthe nullness of an allele in a diploid organism: If theabnormal phenotype seen in a homozygote for theallele is identical to that seen in a heterozygote(where one chromosome carries the allele in question and the homologous chromosome is known tobe completely deleted for the gene) then the alleleis null. What is the underlying rationale for thistest? What limitations might there be in interpreting such a result?
Price et al. [(1999). J. Bacteriol. 181:2358–2362] conducteda genetic study of the toxin transport protein (PA) of Bacillusanthracis, the bacterium that causes anthrax in humans. Withinthe 2294-nucleotide gene in 26 strains they identified five pointmutations—two missense and three synonyms—among differentisolates. Necropsy samples from an anthrax outbreak in 1979revealed a novel missense mutation and five unique nucleotidechanges among ten victims. The authors concluded that thesedata indicate little or no horizontal transfer between differentB. anthracis strains. Question: Which types of nucleotide changes (missense or synonyms)cause amino acid changes?
Price et al. [(1999). J. Bacteriol. 181:2358–2362] conducteda genetic study of the toxin transport protein (PA) of Bacillusanthracis, the bacterium that causes anthrax in humans. Withinthe 2294-nucleotide gene in 26 strains they identified five pointmutations—two missense and three synonyms—among differentisolates. Necropsy samples from an anthrax outbreak in 1979revealed a novel missense mutation and five unique nucleotidechanges among ten victims. The authors concluded that thesedata indicate little or no horizontal transfer between differentB. anthracis strains. Question: On what basis did the authors conclude that evidence ofhorizontal transfer is absent from their data?
Price et al. [(1999). J. Bacteriol. 181:2358–2362] conducteda genetic study of the toxin transport protein (PA) of Bacillusanthracis, the bacterium that causes anthrax in humans. Withinthe 2294-nucleotide gene in 26 strains they identified five pointmutations—two missense and three synonyms—among differentisolates. Necropsy samples from an anthrax outbreak in 1979revealed a novel missense mutation and five unique nucleotidechanges among ten victims. The authors concluded that thesedata indicate little or no horizontal transfer between differentB. anthracis strains. Question: What is meant by ”horizontal transfer”?
What Art the Features of the Series of -omes? Define the following terms: a. Genome b. Transcriptome c. Proteome d. Metabolome e. Fluxome
Utilizing Hind III and EcoR V Restriction Enzyme with Pet41 and the following gene of interest... a tgaaacaaca aaaacggctt tacgcccgat tgctgacgct gttatttgcg 61 ctcatcttct tgctgcctca ttctgcagca gcggcggcaa atcttaatgg gacgctgatg 121 cagtattttg aatggtacat gcccaatgac ggccaacatt ggaagcgttt gcaaaacgac 181 tcggcatatt tggctgaaca cggtattact gccgtctgga ttcccccggc atataaggga 241 acgagccaag cggatgtggg ctacggtgct tacgaccttt atgatttagg ggagtttcat 301 caaaaaggga cggttcggac aaagtacggc acaaaaggag agctgcaatc tgcgatcaaa 361 agtcttcatt cccgcgacat taacgtttac ggggatgtgg tcatcaacca caaaggcggc 421 gctgatgcga ccgaagatgt aaccgcggtt gaagtcgatc ccgctgaccg caaccgcgta 481 atttcaggag aacacctaat taaagcctgg acacattttc attttccggg gcgcggcagc 541 acatacagcg attttaaatg gcattggtac cattttgacg gaaccgattg ggacgagtcc 601 cgaaagctga accgcatcta taagtttcaa ggaaaggctt gggattggga agtttccaat 661 gaaaacggca actatgatta tttgatgtat gccgacatcg attatgacca tcctgatgtc 721 gcagcagaaa ttaagagatg gggcacttgg tatgccaatg aactgcaatt ggacggtttc 781…
The human RefSeq of the entire first exon of a geneinvolved in Brugada syndrome (a cardiac disordercharacterized by an abnormal electrocardiogram andan increased risk of sudden heart failure) is:5′ CAACGCTTAGGATGTGCGGAGCCT 3′The genomic DNA of four people (1–4), three ofwhom have the disorder, was subjected to singlemolecule sequencing. The following sequences represent all those obtained from each person. Nucleotidesdifferent from the RefSeq are underlined. Individual 1:5′ CAACGCTTAGGATGTGCGGAGCCT 3′and5′ CAACGCTTAGGATGTGCGGAGACT 3′Individual 2:5′ CAACGCTTAGGATGTGAGGAGCCT 3′Individual 3:5′ CAACGCTTAGGATGTGCGGAGCCT 3′and5′ CAACGCTTAGGATGGCGGAGCCT 3′Individual 4:5′ CAACGCTTAGGATGTGCGGAGCCT 3′and5′ CAACGCTTAGGATGTGTGGAGCCT 3′a. The first exon of the RefSeq copy of this gene includes the start codon. Write as much of the aminoacid sequence of the encoded protein as possible,indicating the N-to-C polarity.b. Are any of these individuals homozygotes? If so,which person and what allele?c. Is…
Robert Bost and Richard Cribbs studied a strain of E. coli (araB14)that possessed a nonsense mutation in the structural gene that encodes Lribulokinase,an enzyme that allows the bacteria to metabolize the sugararabinose (R. Bost and R. Cribbs. 1969. Genetics 62:1–8). From thearaB14 strain, they isolated some bacteria that possessed mutations thatcaused them to revert back to the wild type. Genetic analysis of theserevertants showed that they possessed two different suppressormutations. One suppressor mutation (R1) was linked to the originalmutation in L-ribulokinase and probably occurred at the same locus. Byitself, this mutation allowed the production of L-ribulokinase, but theenzyme produced was not as effective in metabolizing arabinose as theenzyme encoded by the wild-type allele. The second suppressormutation (SuB) was not linked to the original mutation. In conjunctionwith the R1 mutation, SuB allowed the production of L-ribulokinase, butSuB by itself was not able to suppress the…

SEE MORE QUESTIONS

Recommended textbooks for you

Biochemistry

ISBN:

9781305577206

Author:

Reginald H. Garrett, Charles M. Grisham

Publisher:

Cengage Learning

Biochemistry

ISBN:

9781305577206

Author:

Reginald H. Garrett, Charles M. Grisham

Publisher:

Cengage Learning

SEE MORE TEXTBOOKS