1.You are investigating a protein that has the amino acid sequenceN ... Ala – Thr - Asn – Trp – Lys - Arg - Gly – Phe – Thr ... Cwithin its primary structure. You found that several of the mutations affecting this proteinproduced shortened protein molecules that terminated within this region. In one of the mutants,the Asn became the terminal (last) amino acid.(a) What DNA single-base changes(s) would cause the protein to terminate at the Asnresidue?(b) What other potential sites do you see in the DNA sequence encoding this protein wheremutation of a single base pair would cause premature termination of translation?> FontParagraphStylesDictateSensitivityThe human gene for B2 lens crystalline has the components listed below. Thenumbers represent nucleotide pairs that make up the particular component. Assume forsimplicity that no alternative splicing is involved and splicing occurs after transcription.5 UTR1st exon1st intronond exon1741195323372nd intron3rd exon3rd intron14312083804th exon4444th intron5th exon995463 UTR715Answer the following questions about the B2 lens crystalline gene, primary transcript, and geneproduct. Questions asking where should be answered with one of the 11 components from the list orwith None. Assume that poly-A tails contain 150 As. (Hint: make a sketch, above or on scratch paper)a. How large is the B2 lens crystalline gene in bp (base pairs)?b. How large is the primary transcript for B2 lens rystalline in bases?c. How large is the mature mRNA for B2 lens crystalline in bases?>d. Where would you find the base pairs encoding the initiation codon?c. Where would you find the base pairs encoding the stop codon?107%FocusPage 4 of 111688 wordsAa

Name: 1.You are investigating a protein that has the amino acid sequenceN .
Uploaded: 2024-03-20T06:42:55.000Z
Channel: Bartleby
Description: 1.You are investigating a protein that has the amino acid sequenceN ... Ala – Thr - Asn – Trp – Lys - Arg - Gly – Phe – Thr ... Cwithin its primary structure. You found that several of the mutations affecting this proteinproduced shortened protein m

BASIC INFORMATION GENETIC CODE The codes are written in a group of three thus it is triplet.…

Science

Biology

1. You are investigating a protein that has the amino acid sequence N... Ala – Thr - Asn – Trp – Lys – Arg – Gly – Phe – Thr ... C within its primary structure. You found that several of the mutations affecting this protein produced shortened protein molecules that terminated within this region. In one of the mutants, the Asn became the terminal (last) amino acid. (a) What DNA single-base changes(s) would cause the protein to terminate at the Asn residue? (b) What other potential sites do you see in the DNA sequence encoding this protein where mutation of a single base pair would cause premature termination of translation?

1. You are investigating a protein that has the amino acid sequence N... Ala – Thr - Asn – Trp – Lys – Arg – Gly – Phe – Thr ... C within its primary structure. You found that several of the mutations affecting this protein produced shortened protein molecules that terminated within this region. In one of the mutants, the Asn became the terminal (last) amino acid. (a) What DNA single-base changes(s) would cause the protein to terminate at the Asn residue? (b) What other potential sites do you see in the DNA sequence encoding this protein where mutation of a single base pair would cause premature termination of translation?

Human Heredity: Principles and Issues (MindTap Course List)

11th Edition

ISBN:9781305251052

Author:Michael Cummings

Publisher:Michael Cummings

Chapter11: Genome Alterations: Mutation And Epigenetics

Section: Chapter Questions

Problem 10QP: If the coding region of a gene (the exons) contains 2,100 base pairs of DNA, would a missense...

See similar textbooks

Similar questions

A particular protein has the amino acid sequenceN . . . Ala-Pro-His-Trp-Arg-Lys-Gly-Val-Thr . . . Cwithin its primary structure. A geneticist studyingmutations affecting this protein discovered that several of the mutants produced shortened protein molecules that terminated within this region. In one ofthem, the His became the terminal amino acid.a. What DNA single-base change(s) would cause theprotein to terminate at the His residue?b. What other potential sites do you see in the DNAsequence encoding this protein where mutation ofa single base pair would cause premature termination of translation?
1. what will be the mRNA complimentary strand of a DNA sequence AATCGGCTGGGATTA? a. UUAGCCGACCCUAAU b. AAUCGGCUGGGAUUA c. TTAGCCGACCCTAAT d. UUTCGGCTGGGUTTU 2. what will be the amino acid sequence of DNA with a sequence AATCGGCTGGGATTA? a. leucine - alanine - aspartic acid - serine - aspagarine b. leucine - threonine - aspartic acid - serine - aspagarine c. leucine - alanine - aspartic acid - proline - aspagarine d. tyrosine - alanine - aspartic acid - proline - aspartic acid 3. what type of points mutation happened if the mutated DNA sequence is TTA-CAG-CAG-GGT-GGC? a. addition b. deletion c. insertion d. subtitution 4. if the first nitrogenous base "T" will be replaced by "G" ; what will be the resulting amino acid for the first codon? a. isoleucine b. leucine c. tyrosine d. trytophan 5. what type of point mutation happened if the mutated DNA sequence is TTS-CGC-AGG-GTG-GC? a. addition b. deletion c. insertion d. substitution
Given the following Wild Type and Mutated DNA sequences: 1.) Identify where the base pair change occurs (what letters changed?) 2.) For BOTH sequences, write the mRNA strands, define the codon regions (with spaces), and amino acid sequences. 3.) Describe what kind of mutation has occurred (missense, nonsense, or silent), and what effect this may have on the protein. Wild Type DNA Sequence: 3' - CCTCGTTATGTG - 5' Mutated DNA Sequence: 3' - CCTCGTTATTTG - 5'
How many binary sequences of length n contain at most five 1 digits? The genetic code specifies an amino acid through a sequence of three nucleotides. Each nucleotide can be of one of the four types T, A, C and G, beingrepetitions allowed. How many amino acids can be encoded in this way?And if there are n types. Compare
While studying the structure of a small gene that was recently sequenced duringthe Human Genome Project, an investigator notices that one strand of the DNAmolecule contains 20 As, 25 Gs, 30 Cs, and 22 Ts. How many of each base isfound in the complete double-stranded molecule?
. Geneticists interested in human hemoglobins havefound a very large number of mutant forms. Some ofthese mutant proteins are of normal size (but haveamino acid substitutions) while others are short, dueto deletions or nonsense mutations. The first extralong example was named Hb Constant Spring, inwhich the β-globin has all of its normal amino acidsplus several extra amino acids attached after thenormal C-terminal end of the protein. a. What is the most plausible explanation forits origin?b. Is it possible that Hb Constant Spring arose fromfailure to splice out an intron?c. Estimate how many extra amino acids mightbe added to the C terminal end of the mutantprotein
What will be the order of amino acids derived from the following DNA sequence 5’-TGATCGCACAAT-3’? Explain briefly. (1.5) If the base G (denoted by an asterisk) in the sequence 5’-TGATCG*CACAAT-3’ is replaced by C due to a mutation, the new sequence will be 5’-TGATCCCACAAT-3’ what will be the new amino acid sequence? Explain briefly. (1.5) If the anticodon sequence of a tRNA is 5’-GCG-3’, what amino acid will it carry? Explain briefly. (1.5) What would be the effect of mutation if the C is changed to A in the anticodon? Explain briefly. (1.5)
-Write down the complementary DNA sequence. TACCTAGCG CACATGTAGGTGGGCAAAGTT -Write down the complementary mRNA sequence for each of the following DNA sequence. A: TACCTAGCGCACATGTAGGTGGGCAAAGTT B: TAC ATG GTT ACA GTC TAT TAG ATG CTA TTT ACT TAG -If the first G changes to A what kind of mutation will happen? Show the change in amino acid sequence. This is base substitutions involve the replacement of one nucleotide with another. And it changes one amino acid coding, producing a missense mutation TAC CTA GCA CAC ATGTAGGTGGGCAAAGTT TAC CTA ACACACATGTAGGTGGGCAAAGTT
6a) Transcribe the following DNA sequence into codons. TACGCGACATTACATGAATCGTTTGGAGATTAGCCCTATTTCTCTAAGAACACGACTb) Excise(cut out) codons numbered 5, 6, and 7. Leave the remaining codons. c) Now translate the sequence . d) Explain how many amino acids are now in your polypeptide? e) What would happen to your polypeptide if either of your cysteine amino acids near the start or end of thepolypeptide were translated incorrectly. f) Based on your final polypeptide can you make the original DNA strand by doing reverse translation andtranscription? g) Explain if your polypeptide similar to your template strand or the complementary strand?
Which of the following sequences is most likely to form a beta-turn? Explain why? Sequence A: Ser-Pro-Asn-Val Sequence B: Gly-Ser-Asn-Pro Sequence C: Ser-Asn-Gly-Val
Given the following DNA sequence: 5’-ATGCGGCCAAGGTCAGAGTGACA-3’ a) If this DNA strand represents the “Sense Strand” of DNA, what would be the RNA sequence? b) If this DNA strand represents the “Antisense Strand” of DNA, what would be the RNA Sequence? c) What would be the other strand of DNA?
Do you think each of the following types of mutationswould have very severe effects, mild effects, or no effectat all?a. Nonsense mutations occurring in the sequences encoding amino acids near the N terminus of the proteinb. Nonsense mutations occurring in the sequences encoding amino acids near the C terminus of the proteinc. Frameshift mutations occurring in the sequences encoding amino acids near the N terminus of the protein d. Frameshift mutations occurring in the sequencesencoding amino acids near the C terminus of theproteine. Silent mutationsf. Conservative missense mutationsg. Nonconservative missense mutations affecting theactive site of the proteinh. Nonconservative missense mutations not in the active site of the protein