2) A few years ago, a graduate student in my lab realized that a DNA construct in which he fused the coding sequence for one protein (the 'Myr-tag') to the coding sequence for another protein ('Kibra'), with a short linker between, was not working properly. The goal of this DNA construct was to express a 'fusion protein' which had the Myr-tag fused to the amino terminal end of the Kibra protein. Looking at the portion of the sequence shown below where the two proteins are fused, why did this experiment fail? The brackets above the DNA sequence show the codons corresponding to the amino acids in the proteins shown below the DNA sequence. The translation start site for the fusion protein is indicated. Translation starts,here 5' CACCÀTGggcaacaaa'tgc'tgcagcaagcgacaggcGCCACCATGccGAAtCTGCACAAAccGcATCGCAATCGCAG 3' iGTGGTACccgttgtttacgacgtcgttcgctgtccgCGGTGGTACGGCTTAGACGTTGTTTGGCGTAGCGTTAGCGTCı _5 Met Gly Asn Lys Cys Cys Ser Lys Arg Gln, Myr tag 1 10 1 Met Pro Asn Leu Gin Gin Thr 10 Ala Ser Gln Ser Gln Linker Kibra

2) A few years ago, a graduate student in my lab realized that a DNA construct in which he fused the coding sequence for one protein (the 'Myr-tag') to the coding sequence for another protein ('Kibra'), with a short linker between, was not working properly. The goal of this DNA construct was to express a 'fusion protein' which had the Myr-tag fused to the amino terminal end of the Kibra protein. Looking at the portion of the sequence shown below where the two proteins are fused, why did this experiment fail? The brackets above the DNA sequence show the codons corresponding to the amino acids in the proteins shown below the DNA sequence. The translation start site for the fusion protein is indicated. Translation starts,here 5' CACCÀTGggcaacaaa'tgc'tgcagcaagcgacaggcGCCACCATGccGAAtCTGCACAAAccGcATCGCAATCGCAG 3' iGTGGTACccgttgtttacgacgtcgttcgctgtccgCGGTGGTACGGCTTAGACGTTGTTTGGCGTAGCGTTAGCGTCı _5 Met Gly Asn Lys Cys Cys Ser Lys Arg Gln, Myr tag 1 10 1 Met Pro Asn Leu Gin Gin Thr 10 Ala Ser Gln Ser Gln Linker Kibra

Name: 2) A few years ago, a graduate student in my lab realized that a DNA
Uploaded: 2024-03-20T06:42:55.000Z
Channel: Bartleby
Description: 2) A few years ago, a graduate student in my lab realized that a DNA construct in whichhe fused the coding sequence for one protein (the 'Myr-tag') to the coding sequence foranother protein ('Kibra'), with a short linker between, was not working pro

Biology: The Dynamic Science (MindTap Course List)

4th Edition

ISBN:9781305389892

Author:Peter J. Russell, Paul E. Hertz, Beverly McMillan

Publisher:Peter J. Russell, Paul E. Hertz, Beverly McMillan

Chapter19: Genomes And Proteomes

Section: Chapter Questions

Problem 1ITD: Below is a sequence of 540 bases from a genome. What information would you use to find the...

See similar textbooks

Similar questions

Which of the following set(s) of primers a–d couldyou use to amplify the following target DNA sequence, which is part of the last protein-coding exonof the CFTR gene?5′ GGCTAAGATCTGAATTTTCCGAG ... TTGGGCAATAATGTAGCGCCTT 3′3′ CCGATTCTAGACTTAAAAGGCTC ... AACCCGTTATTACATCGCGGAA 5′a. 5′ GGAAAATTCAGATCTTAG 3′;5′ TGGGCAATAATGTAGCGC 3′b. 5′ GCTAAGATCTGAATTTTC 3′;3′ ACCCGTTATTACATCGCG 5′c. 3′ GATTCTAGACTTAAAGGC 5′;3′ ACCCGTTATTACATCGCG 5′d. 5′ GCTAAGATCTGAATTTTC 3′;5′ TGGGCAATAATGTAGCGC 3′
Suppose you are a research assistant ina lab studying DNA-binding proteins. You have been giventhe amino acid sequences of all the proteins encoded bythe genome of a certain species and have been asked to findcandidate proteins that could bind DNA. What type of aminoacids would you expect to see in the DNA-binding regions ofsuch proteins? Explain your thinking.
. The physicist Stephen Hawking, famous for his theories about black holes, has lived past the age of 70 withamyotrophic lateral sclerosis (ALS), a paralyzing neurodegenerative disease that is usually fatal at a muchyounger age. Recently, geneticists discovered that amajor cause of ALS is the unusual expansion of ahexanucleotide repeat (5′-GGGGCC-3′) that lieswithin a gene called C9ORF72, at a location outside ofthe gene’s open reading frame (ORF). A single expanded allele is sufficient to cause ALS, but the reasonthe disease allele is dominant remains unclear. Someexperimental results support the theory that the allelemakes a toxic RNA containing the expanded repeat. Ifthis theory is correct, in what ways is the mutant ALScausing allele similar to the mutant allele that causesHuntington disease? In what ways is it similar to themutant allele that causes fragile X syndrome?
Any mutation inside or outside a coding regionthat reduces or abolishes protein activity in one of the manyways previously described is a loss-of-function _______?
Do you think each of the following types of mutationswould have very severe effects, mild effects, or no effectat all?a. Nonsense mutations occurring in the sequences encoding amino acids near the N terminus of the proteinb. Nonsense mutations occurring in the sequences encoding amino acids near the C terminus of the proteinc. Frameshift mutations occurring in the sequences encoding amino acids near the N terminus of the protein d. Frameshift mutations occurring in the sequencesencoding amino acids near the C terminus of theproteine. Silent mutationsf. Conservative missense mutationsg. Nonconservative missense mutations affecting theactive site of the proteinh. Nonconservative missense mutations not in the active site of the protein
While studying the structure of a small gene that was recently sequenced duringthe Human Genome Project, an investigator notices that one strand of the DNAmolecule contains 20 As, 25 Gs, 30 Cs, and 22 Ts. How many of each base isfound in the complete double-stranded molecule?
Although DNA transposons are abundant in the genomes of multicellular eukaryotes, class 1 elements usually make up the largest fraction of very large genomessuch as those from humans (~2500 Mb), maize (~2500Mb), and barley (~5000 Mb). Given what you knowabout class 1 and class 2 elements, what is it about theirdistinct mechanisms of transposition that would accountfor this consistent difference in abundance?
Below is a sequence of 540 bases from a genome. What information would you use to find the beginnings and ends of open reading frames? How many open reading frames can you find in this sequence? Which open reading frame is likely to represent a protein- coding sequence, and why? Which are probably not functioning protein-coding sequences, and why? Note: for simplicitys sake, analyze only this one strand of the DNA double helix, reading from left to right, so you will only be analyzing three of the six reading frames shown in Figure 19.4.
The following represent deoxyribonucleotidesequences in the template strand of DNA:Sequence 1: 5'@CTTTTTTGCCAT@3'Sequence 2: 5'@ACATCAATAACT@3'Sequence 3: 5'@TACAAGGGTTCT@3'(a) For each strand, determine the mRNA sequencethat would be derived from transcription.(b) determine the amino acidsequence that is encoded by these mRNAs.(c) For Sequence 1, what is the sequence of the codingDNA strand?
Consider the following sequence of DNA: 3'-TTA CGG-5'What dipeptide is formed from this DNA after transcription and translation? b. If a mutation converts CGG to CGT in DNA, what dipeptide is formed? c. If a mutation converts CGG to CCG in DNA, what dipeptide is formed? d. If a mutation converts CGG to AGG in DNA, what dipeptide is formed?
What part(s) of a nucleotide (namely, phosphate, sugar, and/or base) is/are found in the major and minor grooves of double-stranded DNA, and what part(s) is/are found in the DNA backbone? If a DNA-binding protein does not recognize a specific nucleotide sequence, do you expect that it binds tothe major groove, the minor groove, or the DNA backbone? Explain.
The best estimate is that the human genome containsfewer than 21,000 genes. However, there is evidencethat human cells produce many more than 21,000 different polypeptides. What processes might account for thisdiscrepancy?