4. (a) Create the complementary strand for the DNA strand below. Make sure to write the direction of the strand. 5'TACGGTCCAGTCCAAGTTACG-3' [2] 4. (b) Write down the MRNA strand sequence from that complementary strand. If the entire sequence of that mRNA strand is capable of making a peptide chain, how many amino acids there would be? [4]

4. (a) Create the complementary strand for the DNA strand below. Make sure to write the direction of the strand. 5'TACGGTCCAGTCCAAGTTACG-3' [2] 4. (b) Write down the MRNA strand sequence from that complementary strand. If the entire sequence of that mRNA strand is capable of making a peptide chain, how many amino acids there would be? [4]

Anatomy & Physiology

1st Edition

ISBN:9781938168130

Author:Kelly A. Young, James A. Wise, Peter DeSaix, Dean H. Kruse, Brandon Poe, Eddie Johnson, Jody E. Johnson, Oksana Korol, J. Gordon Betts, Mark Womble

Publisher:Kelly A. Young, James A. Wise, Peter DeSaix, Dean H. Kruse, Brandon Poe, Eddie Johnson, Jody E. Johnson, Oksana Korol, J. Gordon Betts, Mark Womble

Chapter3: The Cellular Level Of Organization

Section: Chapter Questions

Problem 19RQ: Which of the following is part of the elongation step of DNA synthesis? pulling apart the two DNA...

See similar textbooks

Similar questions

Which of the following is part of the elongation step of DNA synthesis? pulling apart the two DNA strands attaching complementary nucleotides to the template strand untwisting the DNA helix none of the above
How does the double helix structure of DNA support its role in encoding the genome? The sugar-phosphate backbone provides a template for DNA replication tRNA pairing with the template strand creates proteins encoded by the genome Complementary base pairing creates a very stable structure Complementary base pairing allows for easy editing of both strands of DNA.
Describe how the two strands of DNA are oriented with respect to each other.
If the sequence of the 5'-3' strand is AATGCTAC, then the complementary sequence has the following sequence: 3'-AATGCTAC-5' 3'-CATCGTAA-5' c. 3'-TTACGATG-5' d. 3’-GTAGCATT-5'
5’ GGACCTATCAAAATCCTTAATGCGCTAGGATAGCTAACGCATCCAC3’ Fill in the complimentary DNA strand and label the polarity (the 5’ and 3’ ends)
DNA STRAND IS 3’ TAC-AGC-ACT-CAG-TCA 5’a. what is the non-template/sense/coding strand?b. What is the arrangement of the m-RNA?c. What's the chain arrangement of the amino acids that will be made according to the order of the RNA?d. If on the non-coding strand of DNA there is suddenly one T base that sneaks into the 4th sequence (from the left), or causes a mutation, then how will the RNA be formed?e. What's the chain arrangement of the amino acids produced by this mutation?
Given the following DNA sequence: 5’-ATGCGGCCAAGGTCAGAGTGACA-3’ a) If this DNA strand represents the “Sense Strand” of DNA, what would be the RNA sequence? b) If this DNA strand represents the “Antisense Strand” of DNA, what would be the RNA Sequence? c) What would be the other strand of DNA?
1. What is the nucleotide sequence of the complementary strand of the DNA molecule: 5’-AATGCGATCTTCAT-3’?2. What is the nucleotide sequence of the mRNA transcribed from the template DNA strand: 3’-GCTACAAAAAGTCCATAATCGC-5’? Indicate the 5’ and 3’ ends.3. If the mRNA sequence you obtained in question 2 were to be translated, what would be the sequence of amino acids? Indicate the N-terminal and C-terminal amino acids.
3’atgtaccatgcgcaaatttaaaggccc5’. a) Using this single template strand of a DNA as a template, write the base sequence of the complementary strand. b) List the molecules must be present for DNA to be replicated and briefly describe their function.
One strand of a double-helical DNA has the sequence (5’)GCTCAATATTTCTCAAAAT ATTGCGC(3’). Write the base sequence of the complementary strand. What special type of sequence is contained in this DNA segment?
Give the corresponding strand of the DNA having the sequence of:a. 5’ ATGGCTAGGATCGGTAACTGCGATCGATCAGCATGACTAG-3’b. 3’ TACCAGGATAATTCGAGGTACTACGACTAGGAT-5’c. 5’ AACATGATCTGGTCCATTAGCTTGTTCAATAATTAGC-3’
1. From the given DNA strands:a. Identify the template and non-template strand.b. Give the mRNA product when the DNA is transcribed.c. What is the resulting amino acid sequence which will result from the mRNA?