2. Which of the following macro-molecule can be most structurally diverse among this living world? A. carbohydrates B. proteins C. nucleic acids D. lipids

Q: Draw the Fischer projection formula for each sugar and give the importance/use of each. 1. D- glycer...

A: Note : Hi ! Thank you for the question. We are authorized to answer three subparts at a time. Since ...

Q: Some of the following four amino acids : alanine, arginine, histidine, aspartic acid would provide a...

A: Acid-Base Catalysis is involved in the reaction mechanisms that requires the transfer of a proton fr...

Q: why the hemacytometer method is not compatible with mycelium b. Explain at what stage of growth the ...

A: Cell counting:  Hemocytometer or cell counting chember is used for primary cell counting, where a th...

Q: Enzymes

A: Enzymes are proteins that enable our bodies' metabolism, or chemical reactions, go more quickly. The...

Q: Given the following reaction, identify the class and subclass of the enzyme involved. CH,OPO,2- CH,O...

A: Enzymes are biocatalysts that speed up biochemical reactions. These are mainly three dimensional glo...

Q: An infant with corneal clouding has dermatan sulfate and heparan sulfate in his urine. Decreased act...

A: Introduction:  The syndrome is also known as mucopolysaccharide type I (MPS I). It is an autosomal r...

Q: C2H5 - CH3-CH-CH-CH2-CH2CH2-CH2-CH3 b. CH3-CH2-CH2-NH-CH3 NH2

A: Here we will be assigning IUPC name for given amines following the general rules of IUPAC nomenclatu...

Q: Which drug, depending on the dosage, can be a hallucinogen, stimulant, depressant, or painkiller? a....

A: Drugs are classified according to their effects on our bodies: - Stimulant: - Stimulant drugs enhan...

Q: Which of the following statements regarding size exclusion chromatography is false?     During siz...

A:            Hi! Thank you for the question, as per the honor code, we are allowed to answer the first...

Q: Bradford technique

A: The Bradford assay is based on the use of the dye Coomassie Brilliant Blue G-250, sometimes known as...

Q: electrical conductivity

A: Here they are talking about electrical conductivity. The counterpart of electrical resistivity is el...

Q: Propose a reasonable biosynthesis for Compound 14 starting from Acetyl CoA, SAM, S- alanine, S-pheny...

A: Here compound 14 is synthesized from L-Phenylalanine in multistep process. The structure of all the ...

Q: explain with proper details please. Compare the net production of ATP from four molecules of glucos...

A: Glucose is a carbohydrate and it is degraded into carbon dioxide through glycolysis, pyruvate dehydr...

Q: 3. The trp repressor is a homodimer with 107 amino acid residues per monomer. The content of proton ...

A: As content of proton dissociable group presented in table, here we can count the charge status of di...

Q: Branched polysaccharides will be more viscous than linear polysaccharides.  True  False

A:      The molecular formula of glucose is C6H12O6. Glucose is a building block of disaccharides like ...

Q: Esterase hydrolyzes ester bonds. For simplicity, only the amino acids whose side-chains interact wit...

A: Esterase- group of enzymes which hydrolyses the ester bond from the substrate like acetylcholine, fa...

Q: In polynucleotides, the phosphodiester bond is  between the ______.   a   3’ OH from the 3’ end, ...

A:

Q: Below are the structures of three phosphate-containing molecules. Which one has the lowest Phosphory...

A: Phosphate group is containing one phosphate group atom attached to four oxygen molecule.Various mole...

Q: The main role of carbohydrate in the cell membrane is ____ Select one: a. recognition b. reception c...

A: Carbohydrates are composed of carbon, hydrogen, and oxygen in the ratio of 1:2:1. Carbohydrates are ...

Q: state the form in which the energy is present in the carbonhydrate eaten by the ox

A: Carbohydrates, abbreviated as carbs, are sugar molecules. Carbohydrates are one of three major nutri...

Q: Under what pH conditions can a protein not bind to the beads in a column?     pH = -pKa     pH =...

A: Proteins are composed of amino acids. There are a total of twenty standard amino acids that make up ...

Q: Write the structure formula, three-letter and one-letter abbreviation for each essential amino acid ...

A: Amino acids contain amino group and carboxyl group along with R side chain. The R side chain defines...

Q: Each group will be provided with 20 g double-stranded DNA oligomer in STE buffer (0.1M NaCl/ Tris/ ...

A: Tm, the temperature at which a double stranded DNA is half denatured is dependent on the length and ...

Q: Suppose you want to determine if excessive lipid ingestion altersgene transcription. Describe and ex...

A: Dietary fat is a crucial macronutrient for the increase and development of all organisms. In additio...

Q: e overall outcome of the light reaction

A: here we have been asked what is the overall outcome of light reaction that occurs during photosynthe...

Q: Name the peptide * он H,'N-CH-C-N-CH-C-N-CH-C-O CH, CH-CH, CH, H он H. CH, CH, CH, SH CH, Methionyl-...

A: Peptides are composed of amino acids linked to each other via a peptide bond. Peptides are named fro...

Q: What is insulin resistance? Hypoglycemia? Hyperglycemia? Explain its similarities and differences

A: Insulin is a peptide hormone produced by the beta-cells of islets of Langerhans of the pancreas. It ...

Q: a. Write the structural formula of GAC, a portion of DNA. Write the complementary strand adjacent to...

A: Nucleotides are the building blocks of nucleic acids. Each nucleotide is composed of a nucleoside, w...

Q: Iculate the actual, physiological deltaG for the reaction Phosphocreatine + ADP > creatine + ATP at ...

A: Disclaimer: Since you have asked multiple question, we will solve the first question for you. If you...

Q: 2) a. Give the name of the following glycoside: но. он но но b. Draw the structure of the disacchari...

A: In the question 2a, the compound has D-mannose sugar linked to a phenyl ring with O-glycosidic bond ...

Q: Given the following reaction, identify the class and subclass of the enzyme involved. CH,OPO,2- он Ç...

A: Enzymes are the chemical substances that catalyse reactions by decreasing their activation energy. T...

Q: 29. Here is a strand of DNA: TACCCGGTATAACGCTGGAAAGCTTAAGCAACATCGCCCGACCCC AAATCT ATGGGCCATATTGCGACC...

A: DNA strand given here with directionality is as: 5’ TACCCGGTATAACGCTGGAAAGCTTAAGCAACATCGCCCGACCCCAAA...

Q: QUESTION 10 n polynucleotides, the phosphodiester bond is between the O 3' OH from the 3' end, and 4...

A:

Q: Provide one important function of activated APC?

A: “Since you have asked multiple questions, we will solve the first question for you. If you want any ...

Q: Q1: Explain the effect of pH value on the amino acid ionization. Q2: Describe two reactions for amin...

A: Amino acids and their ionization: Amino acids are the basic building blocks of proteins, they are bi...

Q: For each polypeptide derived in the following sequences: 5' CAA GAG GUA UCC UAC AGA 3' 5' GUC AUC U...

A: Polypeptides are composed of amino acids linked to each other via  peptide bonds. The peptide bond i...

Q: Give 5 examples of molybdenum complexes. State their physical and chemical properties and their impo...

A:        The atomic number of molybdenum is 42 and it is represented by the symbol 'Mo'. On the earth,...

Q: Under typical conditions, how many protons are pumped across the mitochondrial intermembrane for eac...

A: NADH is the electron carrier that transfers electrons to complex 1 in respiratory chain . In respons...

Q: Why does it make sense that under conditions of low ATP levels in the cell the pyruvate carboxylase ...

A: Glucose is degraded to pyruvate through the process of glycolysis that occurs in the cytoplasm. Glyc...

Q: 1) Below you are given the structures of the disaccharides lactose and trehalose. но OH OH OH но но ...

A: Lets first assume that all the carbohydrates given here are D isomers , cause that the general case ...

Q: The cell concept CANNOT apply to ____

A: Cell theory (a unifying principle of biology) was formulated by Schleiden and Schwann. Cell theory s...

Q: Biochemistry Question: Nonenzymatic glycosylation or glycation creates glycoproteins by

A: What is glycoproteins: Glycoproteins are molecules that comprise protein and carbohydrate chains tha...

Q: label all 5 identified regions in the active site, (labels like basic catalytic residue, acidic cata...

A: In the given image tricarboxy-propanol-1 is present at the active site of enzyme and is surrounded b...

Q: Give at least two (2) chemical tests for amino acids/ proteins other than what were performed in thi...

A: In biochemistry , a chemical test is performed in qualitative or quantitative procedure to identify ...

Q: Show the amount of ATP were produced in beta-oxidation of lauric acid, and differentiate both the GR...

A: Lauric acid has a 12-carbon backbone and is a saturated medium-chain fatty acid. Under anaerobic and...

Q: Bradford technique makes use of the Coomassie blue dye that binds to the protein, with the complex a...

A: Coomassie blue is disulphamide triphenyl methyl compound.Coomassie dye binds to proteins through ion...

Q: During SDS-PAGE,  the charge on glycine in the stacking gel is ____________ while the charge on the ...

A: SDS-PAGE is used to separate proteins based upon the relative mobility of charged species. Proteins ...

Q: What is the purpose of DNA methylation? Why is it ineffective in the DNA repair of spontaneous deami...

A: DNA methylation is the process of adding methyl groups to DNA at Nucleotide bases, so that without c...

Q: The protease used in this procedure functions best at 50°C. Would you expect this enzyme to be isola...

A: Microorganisms are classified as, psychrophiles, psychrotrophs, mesophiles, thermophiles, and hypert...

Q: What is an enzyme and what is its function?

A: In our body, various metabolic pathways are present like Glycolysis, glucogenesis, etc. These pathwa...