22. You are studying variation in a human disease gene worldwide. You suspect that the disease iscaused by a missense mutation of the codon TCC to CCC in some individuals. You use a microarrayto assay the genotype of individuals at the polymorphic site, and find the following numbers of eachgenotype in in 3 different populationsPopulationTT countTC countCC countFrench4249Melanesian104050Yoruba43264What is the frequency of the T allele in each population?a. French: 0.09; Melanesian: 0.1; Yoruba: 0.04b. French: 0.3; Melanesian: 0.3; Yoruba: 0.2c. French: 0.3; Melanesian: 0.4; Yoruba: 0.3d. French: 0.7; Melanesian: 0.7; Yoruba: 0.8e. French: 0.1; Melanesian: 0.2; Yoruba: 0.3

The alleles are given in the three population French, Melanesian, Yoruba and the alleles are in TT,…

Answered: 22. You are studying variation in a…

Biology: The Dynamic Science (MindTap Course List)

4th Edition

ISBN:9781305389892

Author:Peter J. Russell, Paul E. Hertz, Beverly McMillan

Publisher:Peter J. Russell, Paul E. Hertz, Beverly McMillan

Chapter19: Genomes And Proteomes

Section: Chapter Questions

Problem 6TYK

See similar textbooks

Similar questions

2. Null mutations are valuable genetic resources becausethey allow a researcher to determine what happens to anorganism in the complete absence of a particular protein. However, it is often not a trivial matter to determinewhether a mutation represents the null state of the gene.a. Geneticists sometimes use the following test forthe nullness of an allele in a diploid organism: If theabnormal phenotype seen in a homozygote for theallele is identical to that seen in a heterozygote(where one chromosome carries the allele in question and the homologous chromosome is known tobe completely deleted for the gene) then the alleleis null. What is the underlying rationale for thistest? What limitations might there be in interpreting such a result?
The results of a paternity test using short tandem repeats are listed in the table below. Whos the daddy? How sure are you?
In DNA-hybridization experiments on six species of plants in the genus Vicia, DNA was isolated from each of the six species, denatured by heating, and sheared into small fragments (W. Y. Chooi. 1971. Genetics 68:213–230). In one experiment, DNA from each species and from E. coli was allowed to renature. The graph shows the results of this renaturation experiment. Q. Can you explain why the E. coli DNA renatures at a much faster rate than does DNA from any of the Vicia species?
1. The first genetic test developed for this disease took advantage of a large family of over 2,000 individuals who lived along Lake Maracaibo in Venezuela. These family members, some with and some without Huntington’s disease, could all trace their ancestry to a single female who settled in the region a number of generations ago.Genomic DNA from family members with and without Huntington’s disease was cut with a set of enzymes that make reproducible cuts at known DNA sequences. These DNA fragments were run on a DNA gel to see which fragments correlated with the presence of Huntington’s disease. a) How might the large number (over 2,000) of family members who have a common ancestor who suffered from Huntington’s disease make it easy to narrow down the gene location of the Huntington’s locus (compared to doing the same experiment with a small family descended from a Huntington’s sufferer)?
8. Using recombinant DNA techniques (which willbe described in Chapter 9), it is possible to take theDNA of a gene from any source and place it on achromosome in the nucleus of a yeast cell. Whenyou take the DNA for a human gene and put it into ayeast cell chromosome, the altered yeast cell canmake the human protein. But when you remove theDNA for a gene normally present on yeast mitochondrial chromosomes and put it on a yeast chromosome inthe nucleus, the yeast cell cannot synthesize the correctprotein, even though the gene comes from the sameorganism. Explain. What would you need to do to ensurethat such a yeast cell could make the correct protein?
3. Now that the sequence of the entire E. coli K12 straingenome (roughly 5 Mb) is known, you can determineexactly where a cloned fragment of DNA came fromin the genome by sequencing a few bases and matching that data with genomic information.a. About how many nucleotides of sequence information would you need to determine exactly where afragment is from?b. If you had purified a protein from E. coli cells,roughly how many amino acids of that proteinwould you need to know to establish which geneencoded the protein?c. You determine 100 nucleotides of sequence ofgenomic DNA from a different E. coli strain, butyou cannot find a match in the E. coli K12 genomesequence. How is this possible?
10. Analyse the following DNA sequences and identify and explain the anomalies you observe. Ifthere is no anomaly specify that as well. a.) 5’ A A T C T A G C T A A T T C G C A A A T T A A T C G 3’3’ T T A G A T C G U T T A A G C G T T U A A T T A G C 5’
1- The following Wild Type DNA codes for color in a lizard living in the Namib Desert (tan sand) a skin colorof reddish brown. This lizard is preyed upon by hawks flying above.Wild Type (Normal) DNADNA Template Strand: TAC-TTC-AAA-CCG-ATTDNA (silent strand): ATG-AAG-TTT-GGC-TAA For number 7, compare this change to the wild type in number 1. Remember that the originalpigment is a different color.7. Let us assume that the following protein (Met-Lys-Phe-Ser) changes the pigment deposited inthe lizard skin to a tan color. Would this be detrimental? Would this be beneficial? Explaineither answer.
If you compare the frequency of the sixteen pos-sible dinucleotide sequences in the E. coli and humangenomes, there are no striking differences except for onedinucleotide, 5ʹ-CG-3ʹ. The frequency of CG dinucleotidesin the human genome is significantly lower than in E. coliand significantly lower than expected by chance. Why doyou suppose that CG dinucleotides are underrepresentedin the human genome?
4. A recent estimate of the rate of base substitutions atSNP loci is about 1 × 10−8 per nucleotide pair pergamete.a. Based on this estimate, about how many de novomutations (that is, mutations not found in the genomes of your parents) are present in your own genome?b. Where and when did these de novo mutations inyour genome most likely occur?
I sequence the DNA of 3 people and see variation in my gene of interest as follows: Person 1: ATGCAACAATTTAATAAT Person 2: ATGCAACGACGACGACGACAATTTAATAAT Person 3: ATGCAACGACGACGACGACGACGACGACGACAATTTAATAAT What is the name for this kind of variation?
31. A great deal of current molecular genetic research is focused on: A) the 97 percent of the human genome that is known to code for proteins B) the 20 percent of the human genome that is known to code for proteins C) the 3 percent of the human genome that is known to code for proteins D) the 1.5 percent of the human genome that is known to code for proteins

SEE MORE QUESTIONS

Recommended textbooks for you

Biology: The Dynamic Science (MindTap Course List)

Biology

ISBN:

9781305389892

Author:

Peter J. Russell, Paul E. Hertz, Beverly McMillan

Publisher:

Cengage Learning

Biology: The Unity and Diversity of Life (MindTap…

Biology

ISBN:

9781305073951

Author:

Cecie Starr, Ralph Taggart, Christine Evers, Lisa Starr

Publisher:

Cengage Learning

Biology: The Unity and Diversity of Life (MindTap…

Biology

ISBN:

9781337408332

Author:

Cecie Starr, Ralph Taggart, Christine Evers, Lisa Starr

Publisher:

Cengage Learning

Biology: The Dynamic Science (MindTap Course List)

Biology

ISBN:

9781305389892

Author:

Peter J. Russell, Paul E. Hertz, Beverly McMillan

Publisher:

Cengage Learning

Biology: The Unity and Diversity of Life (MindTap…

Biology

ISBN:

9781305073951

Author:

Cecie Starr, Ralph Taggart, Christine Evers, Lisa Starr

Publisher:

Cengage Learning

Biology: The Unity and Diversity of Life (MindTap…

Biology

ISBN:

9781337408332

Author:

Cecie Starr, Ralph Taggart, Christine Evers, Lisa Starr

Publisher:

Cengage Learning

Biology (MindTap Course List)

Biology

ISBN:

9781337392938

Author:

Eldra Solomon, Charles Martin, Diana W. Martin, Linda R. Berg

Publisher:

Cengage Learning

Biochemistry

ISBN:

9781305577206

Author:

Reginald H. Garrett, Charles M. Grisham

Publisher:

Cengage Learning

SEE MORE TEXTBOOKS