6. Section 2.6 describes several lines of support for the concept that "that variation in DNA on its own does not lead to disease but, instead, alters molecular traits that go on to affect disease risk" using the FADS gene cluster and cardiovascular disease as a discussion point. a. What is a SNP (i.e. define)? Design a fake, aligned 20 bp sequence (i.e. using AGCTS) between 5 individuals (please use a monospaced font that aligns letters, e.g. Courier New). Show a SNP at 1 position within this population of 5 individuals.

6. Section 2.6 describes several lines of support for the concept that "that variation in DNA on its own does not lead to disease but, instead, alters molecular traits that go on to affect disease risk" using the FADS gene cluster and cardiovascular disease as a discussion point. a. What is a SNP (i.e. define)? Design a fake, aligned 20 bp sequence (i.e. using AGCTS) between 5 individuals (please use a monospaced font that aligns letters, e.g. Courier New). Show a SNP at 1 position within this population of 5 individuals.

Biochemistry

9th Edition

ISBN:9781319114671

Author:Lubert Stryer, Jeremy M. Berg, John L. Tymoczko, Gregory J. Gatto Jr.

Publisher:Lubert Stryer, Jeremy M. Berg, John L. Tymoczko, Gregory J. Gatto Jr.

Chapter1: Biochemistry: An Evolving Science

Section: Chapter Questions

Problem 1P

See similar textbooks

Similar questions

which of the following statements about genome-wide association studies (GWAS) is correct? A) involves scanning the genomes of thousands of unrelated individuals with a particular mutation and comparing them with the genomes of individuals who do not have the mutation. B) involves scanning the genomes of thousands of unrelated individuals with a particular disease and comparing them with the genomes of individuals who do not have the disease C) attempt to identify genes that influence mutation risk D) attempt to identify genes that influence disease risk E) involves scanning the genomes of thousands of unrelated individuals with a particular disease and comparing them with the genomes of individuals who do not have the disease and GWAS attempt to identify genes that influence disease risk
I sequence the DNA of 3 people and see variation in my gene of interest as follows: Person 1: ATGCAACAATTTAATAAT Person 2: ATGCAACGACGACGACGACAATTTAATAAT Person 3: ATGCAACGACGACGACGACGACGACGACGACAATTTAATAAT What is the name for this kind of variation?
. Discuss how Genome-wide association studies (GWAS) can be used to identify genetic risk loci for (a) diseases with complex inheritance and (b) pharmacogenomic genotype-phenotype associations. Draw on specific examples and experimental evidence in your discussion.
In DNA-hybridization experiments on six species of plants in the genus Vicia, DNA was isolated from each of the six species, denatured by heating, and sheared into small fragments (W. Y. Chooi. 1971. Genetics 68:213–230). In one experiment, DNA from each species and from E. coli was allowed to renature. The graph shows the results of this renaturation experiment. Q. Notice that, for the Vicia species, the rate of renaturation is much faster in the first hour and then slows down. What might cause this initial rapid renaturation and the subsequent slowdown?
Discuss the societal impacts of the use of transgenic Golden Rice. What are some potential benefits and adverse effects of its use?.
What are the different genetic markers that genome-wide association studies (GWAS) employ? How can scientists use this data to calculate the disease risk associated with each variation?
You learned in Problem 21 in Chapter 7 that theneurodegenerative disease ALS can be caused by expansion of a hexanucleotide repeat region (5′-GGGGCC-3′)outside of the open reading frame (but within the firstintron) of the gene called C9ORF72. While a normalC9ORF72 allele has 2–23 copies of the hexanucleotiderepeat unit, dominant disease-causing alleles have hundreds or even thousands of copies. Researchers observed that the first intron of theC9ORF72 disease allele is transcribed not only fromthe normal template strand of DNA, but also from thenontemplate strand. Even more unusual, both types ofrepeat-region transcripts are translated in all six readingframes in an AUG-independent manner—a processcalled repeat-associated non-ATG translation, or RANtranslation. These discoveries led to the hypothesisthat the proteins made from the repeats mightcontribute to ALS.a. What polypeptides are made from the repeat-regiontranscripts?b. According to the RAN translation hypothesis, whyare…
5. A haplotype is a specific set of SNPs and other genetic variants observed on a single chromosome or part of a chromosome, as compared between individuals in a population. Shown below are eight DNA sequences from different individuals: Nucleotide Position 1 5 10 15 Sequence 1. TCTGGAT CAT CACAT Sequence 2. ACAGCAT CATIA CGT Sequence 3. TCAGGAT CATIA CAT. Sequence 4. TCAGGAT CATI A CAT. Sequence 5. ACAGCATCATI ACGT Sequence 6. TCT G GAT CAT CACAT Sequence 7. TCAGGAT CATI A CAT. Luis Pagoada Sequence 8. ACAGCAT CAT IACGT. a. Give the nucleotide positions of all single nucleotide polymorphisms (SNPs; nucleotide positions where individuals vary in which base is present) in these sequences. b. How many different haplotypes (sets of linked variants) are found in these eight sequences?
5. Chapter 21 describes two blotting methods (i.e., Northern blottingand Western blotting) used to detect gene products. Northern blottingdetects RNA and Western blotting detects proteins. Supposethat a female fruit fly is heterozygous for a maternal effect gene,which we will call gene B. The female is Bb. The normal allele, B,encodes a functional mRNA that is 550 nucleotides long. A recessiveallele, b, encodes a shorter mRNA that is 375 nucleotideslong. (Allele b is due to a deletion within this gene.) How couldyou use one or more of these techniques to show that nurse cellstransfer gene products from gene B to developing oocytes? Youmay assume that you can dissect the ovaries of fruit flies and isolateoocytes separately from nurse cells. In your answer, describeyour expected results.
Describe the methodology that you would use to determine the association between specific sequence variations or epigenetic modifications and observed diseases in humans. Given your newfound knowledge of this association how would you then design a genetic test that could be used to identify individuals within a given population who have developed the disease or at risk of developing the disease. “The disease” here refers to any heritable genetic disease..
1. The first genetic test developed for this disease took advantage of a large family of over 2,000 individuals who lived along Lake Maracaibo in Venezuela. These family members, some with and some without Huntington’s disease, could all trace their ancestry to a single female who settled in the region a number of generations ago.Genomic DNA from family members with and without Huntington’s disease was cut with a set of enzymes that make reproducible cuts at known DNA sequences. These DNA fragments were run on a DNA gel to see which fragments correlated with the presence of Huntington’s disease. a) How might the large number (over 2,000) of family members who have a common ancestor who suffered from Huntington’s disease make it easy to narrow down the gene location of the Huntington’s locus (compared to doing the same experiment with a small family descended from a Huntington’s sufferer)?
Relate the importance of the large poputations of studies in 2012: The 1000 genomes project using as genomic landmarks Single nucleotide polymorphisms (SNPs)