27. Match the following three words to its correct definition.  a.) Transformation b.) Transduction c.) Conjugation -Uptake of DNA from the environment -Transfer of DNA by one bacterium to another by a viral vector -Transfer of replicated DNA from a donor to a recipient

Q: 1. If the hydrophobic solvent hexane (C6H14) was the "solvent of life", predict the following and…

A: The structure of biological macromolecules is determined by noncovalent interactions like…

Q: Nucleic acids are polymers of nucleotides linked 3' to 5' by from which the bases project. O…

A: Nucleic acids are biomolecules that carry genetic information from one generation to the next…

Q: Sugar Molisch's Solution Test Glucose Sucrose Lactose Hydrolysis: Samples Sucrose hydrolysate Starch…

A: Qualitative tests are used to determine for the presence or absence of any substance in the given…

Q: Which of the following best describes the function of high energy phosphate compounds in metabolism?…

A: Phosphate compounds seen in lifeforms can be broadly divided into low energy and high energy…

Q: 1. Describe how each of the following modes of analysis may be used to measure enzyme activity:…

A: Since you have posted multiple questions with multiple sub parts, we will provide the solution only…

Q: Some types of tumors express cell-surface receptors that are specific for unique peptide sequences.…

A: Of these 9 amino acids, 7 amino acids(H,W,S,Y,L,P,G) will be carrying a positive charge at pH 4. At…

Q: d. Much of the experimental research on the propagation of nerve signals has focused on an…

A: Nernst potential (V) can be calculated using following equation V = RT/zF ln (Xout/Xin) where V is…

Q: Using the tree structures for the following monosaccharides and comparing to that for glucose, draw…

A: Carbohydrates are polyhydroxy aldehydes or ketones. They can be classified as monosaccharides,…

Q: 1. What do the drops of NaOH indicate in terms of metabolic output (Hint: what causes carbon dioxide…

A: Aerobic respiration is a metabolic process that requires oxygen and produces ATP, a molecule that…

Q: Peptides have been discovered that display anti-inflammatory properties and show promise as new…

A: MTADV is a synthetic pentapeptide which can be a potential novel drug with anti-inflammatory…

Q: 7. You have a 200 mg/mL stock solution of protein. To make 20mL of 5mg/mL solution, add of stock and…

A: Dilution results in a decrease in the concentration of a substance in a mixture. A stock solution is…

Q: Can you draw the table in paper instead?

A: During translation protein synthesis occurs from RNA. The sequence of nucleotides in RNA act as code…

Q: Consider the following peptide: alanyl-glutamyl-lysyl-cysteyl-asparagine. 1- Write the…

A: The given peptide is comprised of 5 amino acids. In order to write the name of a peptide , we add…

Q: Reabsorption of this substance involves carbonic anhydrase - inulin - bicarbonate - glucose -…

A: Enzymes are biocatalyst that increases the speed of reaction by lowering the activation…

Q: Consider the following experimental data from another experiment: [S] 1.5 2.00 2.50 5.00 10.00 V (No…

A: Parameters such as Km and Vmax are used for comparing enzyme activities. If we know the initial rate…

Q: 6. Retroviruses have an RNA genome instead of a DNA genome, and the RNA must be copied into the…

A: Retroviruses are a type of virus that has a unique way of replicating their genetic material. Unlike…

Q: 1. Hydrolysis of 1 M glucose 6-phosphate catalyzed by glucose 6-phosphatase is 99% complete at…

A: Standards free energy change calculated at biochemical standards is called biochemical standard free…

Q: Name of Enzyme Hexokinase Phosphohexose isomerase Phosphofructokinase Aldolase Isomerase…

A: Introduction Glycolysis is a process by which glucose breaks and produces pyruvate. Glycolysis…

Q: In the traditional alkaline lysis method of Solution 1, what is the purpose of Tris pH 8 with HCl?

A: The traditional alkaline lysis method is a widely used and classic technique for isolating plasmid…

Q: Sketch the following two tripeptide chains: Asp-Gly-Ser and Ile-Asn-Met at physiological pH .…

A: Peptide are composed of 5-10 amino acids linked by peptide/amide bonds. Alpha carbon of amino acids…

Q: 1. Discuss the 2 mechanisms by which Chloride maintains electrical neutrality.

A: “Since you have posted multiple questions, we will provide the solution only to the first question…

Q: Some scientists debate whether it is correct to consider pyruvate as  “the end of glycolysis”.…

A: Introduction All living organisms require energy. They get energy from cellular respiration.…

Q: Design an assay with purified phycocyanin to test protein stability using 500ml of 95% ethanol. Then…

A: Phycocyanin is a pigment that is found in cyanobacteria and algae. It’s a member of the…

Q: Name the most important proteins in plasma and their functions.

A: Plasma contains a complex mixture of proteins, most of which are synthesized in the Liver.

Q: Draw and give the name of the following lipid compounds: A. a saturated fatty acid with 18 carbons…

A: Since you have posted a question with multiple sub parts, we will provide the solution only to the…

Q: The hydrolysis of ATP has an enthalpy and entropy of -24.3 kJ/mol and +21.6 J.K-1.mol-1,…

A: ATP (Adenosine Triphosphate) is an important molecule in living organisms as it provides energy for…

Q: What is the abbreviated name of the human gene that contains the CAGATTGTGAAGAGGTCTCTTGA? following…

A: Nowadays there are various tools that are used in bioinformatics to find out the gene from the gene…

Q: 23. Which is a general term indicating a carbohydrate polymer? A) Glycan B) Polycarb C) Multimer D)…

A: Chemically carbohydrates are polyhydroxy aldehydes or ketones. They have the general formula :…

Q: Draw the following Lipids in A) Condensed (detailed) Structure, B) its Block Diagram. C)…

A: Lipids are a chemically diverse group of biomolecules that have two things in common: low…

Q: Why is it important to inhibit the Calvin-Benson-Bassham Cycle to have efficient hydrogen production

A: The Calvin-Benson-Bassham cycle is a biochemical reactions that convert light energy into chemical…

Q: 1. Bacteria have a membrane potential, although the mechanisms of how it is maintained differ from…

A: To calculate the number of positive ions needed on the exterior surface of the bacterium to…

Q: In the following polypeptide, which amino acid would be participating in hydrogen bonding with…

A: Alpha helix is one of the most prominent secondary structures formed by polypeptide chains. The…

Q: A synthetic substrate, the para-nitrophenylacetate (PNPA), is used to monitor enzyme activity of…

A: Enzymes are protein that catalyse biochemical reaction. They speed up biochemical reaction but do…

Q: Here you can see a 3D structure of a protein. How many B-sheets does it contain?

A: Every protein structure consists of various 'secondary' structures that are formed as a result of…

Q: 12. Which of the following ligands cannot act as an ambidentate ligand? o nitrite, NO₂ o…

A: Ligand is a molecule which bind reversibly to the protein. A ligand may be any kind of molecule, it…

Q: Prepare a schematic diagram and present it as though it were a Figure in a publication (scientific…

A: Binding of ligand to receptor or protein can be specific and non-specific. For the genuity of the…

Q: For the reaction A + 2 B 3 C + D, what is the magnitude of the rate of change for [D] when [C] is…

A:

Q: FoF1 ATPase is the enzyme that catalyzes ATP synthesis. The enzyme itself is deactivated. ATP. What…

A: Enzymes are biological catalyst that speed up biochemical reactions. Activity of enzymes refers to…

Q: In bacterial transforamtion, how should P+ and P- tubes look like after a successful transformation?

A: The tranformation process refers to introduction of foreign DNA in the bacteria cells. It is a type…

Q: - Calculate ammonium sulphate, NADH, a-ketoglutarate and proteins concentrations in the reaction…

A: In order to calculate the concentration of species in the reaction medium at time =0, we need to…

Q: How to control or take care of microbial metabolism?

A: Microbial metabolism is the pathway followed by microorganisms to obtain the energy (carbon source)…

Q: Which statements decribe the function of the protein encoded by this gene CAGATTGTGAAGAGGTCTCTTGA?…

A: The given sequence belongs to the XPA gene of humans. This responsible for nucleotide excision…

Q: 1.a)From the countries listed which one has the highest percentage of household expenditure towards…

A: Food is an essential requirement for any organism. Food is any substance that is consumed by an…

Q: Assume that the experiments performed in the absence of inhibitors were conducted by adding 5 μL of…

A: We are asked to find some enzyme kinetics parameter that has a unit of s-1 . And in order to find…

Q: Mutations within this gene CAGATTGTGAAGAGGTCTCTTGA are causative of which human diseases? A.…

A: The nucleotide sequence provided corresponds to the XPA gene of humans. This is deduced by doing a…

Q: Use the information on the proteins given to solve the questions:  A. Draw a UV-Vis spectrum of…

A: Chromatography is a laboratory technique used to separate mixtures of different components. It works…

Q: 1. The dipole moment in a water molecule Which statement about hydrogen bonds is NOT true? A)…

A: The noncovalent interactions between molecules include electrostatic interaction, hydrogen bonding ,…

Q: Calculate length of tubes required for desired production rate

A: Proteins Proteins are the long chain of amino acids , they are essential for the structure,…

Q: (d) NH + (a) CH₂ CH₂ (b) O-H-- CH H-C CH₂ CH3 CH₂COOH H H CH₁ CH, (c) 5 5 (b) CH₂ CH₂ CH₂ CH CH (d)…

A: Proteins are the macro molecules that show diversity in their structure by possessing four levels of…

Q: Draw estimated macroscopic currants for Na and k by multiplying the single channel

A: The sodium-potassium pump is also known as the Na+/K+ ATPase pump. It is a type of active transport…

Dissection

Dissection is the process of cutting up the tissue of a dead or live animal or plant, to do anatomical studies and surgical treatments. The purpose of dissection is to learn more about the overall structure of organs and organ systems and thereby understand the physiology of the organism.