5.If the following two primers 3'AAGS' S'CCG3' were used to facilitate the polymerase chain reaction with the DNA sequence shown below, no amplification of the gene would occur. Explain why not. K 5 -СССТАЗ GGCATS S'ATTTC- gene-- 3'TAAAG

5.If the following two primers 3'AAGS' S'CCG3' were used to facilitate the polymerase chain reaction with the DNA sequence shown below, no amplification of the gene would occur. Explain why not. K 5 -СССТАЗ GGCATS S'ATTTC- gene-- 3'TAAAG

Biology: The Unity and Diversity of Life (MindTap Course List)

14th Edition

ISBN:9781305073951

Author:Cecie Starr, Ralph Taggart, Christine Evers, Lisa Starr

Publisher:Cecie Starr, Ralph Taggart, Christine Evers, Lisa Starr

Chapter9: From Dna To Protein

Section: Chapter Questions

Problem 2SQ: A binding .site for RNA polymerase is called a ___ . a. gene b. promoter c. codon d. protein

See similar textbooks

Related questions

Q: 2. One repair mechanism for double-strand breaks involves the unwinding of the damaged DNA followed…

A: Introduction Deoxyribonucleic acid, also known as DNA, is the molecule that carries the genetic…

Q: 3. Now that the sequence of the entire E. coli K12 straingenome (roughly 5 Mb) is known, you can…

A: The complete genome of E.coli is 5.44 million base pairs. The genome is replicated entirely in one…

Q: 2. Scientists now routinely use CRISPR/Cas9 to makedefined deletions of a gene that can remove…

A: Nowadays, scientists are using CRISPR/Cas9 for making necessary deletions in the genome of the…

Q: purpose(s) of DNA extraction

A: The purpose of DNA extraction are: To study the genetic cause of the disease. For the development…

Q: 1.) A portion of a strand of a much longer molecule has a nucleotide sequence AGC – AGG – CAG - ATC,…

A: Deoxyribonucleic acid (DNA) is the genetic material of living organisms. DNA provides the…

Q: 5. The DNA sample in your final vial contains numerous strands of DNA ( 46 chromosomes from EACH…

A: Question : The DNA sample in your final vial contains numerous strands of DNA ( 46 chromosomes…

Q: 5. There are huge amount of DNA in human that are not genetic sequence. Categorize them. The…

A: Minisatellites: They are repetitive sequences of DNA. Repeat length is 10-60 base pairs. Repeated…

Q: 4. Some transposases use extensive DNA replication to leave one copy of the element behind in a…

A: Trnasposases are the enzymes that identify the inverse terminal repeat sequences within the DNA and…

Q: 2. What is the function of each of the replication enzymes listed below? a. DNA polymerase III b.…

A: The DNA replicates itself multiple times during the replication process. It is a biological…

Q: 3. The Watson-Crick model pictures DNA as as the step. spiral staircase with the as the handrails…

A: DNA has a double-stranded structure in which two strands run in an anti-parallel direction. DNA…

Q: 7. If the electrical leads were reversed by mistake (red connected to black), what would be the…

A: Gel electrophoresis is a technique which is used to separate the DNA on ths basis of size, charge…

Q: 3. Why will we put your cheek cells in the InstaGene solution? In other words, why do we want to…

A: DNA isolation is one of the crucial steps in molecular biology and should be performed with care and…

Q: 6. Describe the process of DNA sequence of interest detection, using these term appropriately,…

A: *DNA sequencing is a technique used to find the exact sequence of bases like Adenine, Guanine…

Q: the following mutations silent, missense, nonsense, or frameshift mutations, why? The original…

A: MUTATION:- It is the heritable change in the nucleotide sequence of the genes of an organism.. For…

Q: 4. A woman with skin cancer gets a biopsy of one of her tumors taken, and a sample of her blood. DNA…

A: It is given that The sequence of blood is 5' ATGCAAGTTCTAThe sequence of the tumor is 5' ATGCAAGTCTA…

Q: 5'- ATG CTG TTT GTA CGG GÁC TAA-3' a) Write out the DNA template side for the DNA coding side above?…

A: Introduction The term template strand refers to the sequence of DNA that is copied during the…

Q: 3. Give a schematic diagram of the different steps involved in PCR (Polymerised chain reaction) of a…

Q: 7. Fill in the blank. In the picture below, the oldest spacer that has been incorporated in the…

A: CRISPR is a group of DNA sequences that are found in the genomes of prokaryotic organisms like…

Q: 1)explain why it is far less important for RNA Polymerase to have proofreading activity than it is…

A: Fidelity of replication is the most important for the very existence of an organism. Besides its…

Q: 4. The bars in the following sequence indicate the breakpoints of a deletion.…

A: The given sequence has bars indicating the breakpoint of a deletion means we are going to delete the…

Q: 8. For each of the following DNA template strands a. 3' TACGGC 5' b. 3' CCATTA 5' Determine: a. the…

A: The heterogenous nuclear ribonucleoprotein (hnRNP) is the initial step of synthesizing mRNA during…

Q: 4. If the structure of a fully relaxed, closed-circular DNA molecule is changed so that the specific…

A: DNA is double helical structure which negatively super coil around positively charged histone…

Q: 1. What is the role of salt and dishwashing liquid in the extraction/isolation of DNA from yeast and…

A: "DNA extraction or DNA isolation" is a procedure or a method wherein DNA is purified by physical…

Q: 16. Which of the following enzyme repairs the DNA backbone during molecular cloning (that is you are…

A: Answer: Introduction: Molecular cloning is a genetic methods in biotechnology, which are utilized to…

Q: 2. Give two different reasons for the much higher ratioof total DNA to protein-encoding DNA in the…

A: DNA is a polymer of nucleotides arranged in unique sequence in different organisms. It forms the…

Q: 13- Which statement is not correct for primer design criteria? a) In the length of 18-22 nt b)…

A: A primer is a sequence of short, single-stranded DNA used in the technique of polymerase chain…

Q: blueprint for life?"

A: TE tris-EDTA buffer is an type of biological buffer system that used during isolation of a DNA which…

Q: 1. The two sequences shown below are complementary to each other. T or F GTCGAC CAGCUG

A: Biological macromolecules are those that are made up of large molecules in order to carry out normal…

Q: 1) Explain why the process of DNA replication is slower on the lagging strand than on the leading…

A: DNA replication is a process in which from one Duplex DNA ,two identical copies of DNA is…

Q: The authors investigate if the switch from the polymerase to the exonuclease site involves releasing…

A: During DNA replication, accuracy is determined by rate of nucleotide incorporation by DNA…

Q: 6.You have used the primer 5' CTGA 3' in a DNA sequencing reaction with the template DNA sequence…

A: Sanger sequencing method is also known as chain termination method. It requires - DNA polymerase…

Q: 3. For each of the following characteristics, list all of the bases (A, B, C, or D) to which they…

A: A molecule that consists of Nitrogen and possess the chemical property of a base, is known as a…

Q: 1. Fill in the parent and template strands of DNA below. Next transcribe the RNA from the template…

Q: 6. Jo is completing their undergraduate research project and has run out of Tag polymerase.…

A: PCR or polymerase chain reaction is the method used for amplifying specific DNA regions. This method…

Q: 1. a. Draw the primers for this longer strand (consider optimal length):…

A: Introduction PCR is the revolutionized technique invented by Karry Mullis in 1983, for which he got…

Q: ATT CGG TCG CGC TTA ACG

A: DNA stands for deoxyribonucleic acid which is the most prominent way of storing information among…

Q: What is the name of the process by which bacteria pick up a different organism’s genetic material?

A: 4. A bacterium takes up a fragment of DNA circulating in its surroundings during transformation. A…

Q: 6. Which of the following is NOT a similarity between replication and transcription? A) Both…

A: The process of DNA replication is used to replicate genetic information to create two copies of the…

Q: 7:12 What is not true for Sequence tagged site (STS) markers: O cannot be mapped by fluorescence in…

A: Any sequence of DNA which shows polymorphism and can be recognized utilizing a molecular method is…

Q: 1. What structures are these DNA strand likely to adopt in solution (assuming sufficient salt…

A: A-DNA is one of the possible double helical structures which DNA can adopt. A-DNA is thought to be…

Q: 13. In bacteria, mismatch repair involves: A. DNA glycosylase/lyase B. AP endonuclease C.…

A: Introduction DNA is the hereditary material in humans and almost all other organisms, It transmits…

Q: 7. Discuss the modes of actions by which the following three compounds disrupt DNA- associated…

A: Whether its a cancer cell trying to multiply inorder to generate more cancer cell or a pathogen…

Q: 3. The Watson-Crick model pictures DNA as a as the step. spiral staircase with the as the handrails…

A: The double helical structure of DNA was first proposed by James Watson and Francis Crick. According…

Q: 12. A student drew this diagram to summarize how new DNA strands afe (2) errors in their diagram.…

A: The replication fork is a structure formed when the DNA unwinds the DNA during replication. The…

Q: 7. Which of the following base sequences are probably not recognition sites for cleavage by…

A: Restriction endonucleases are the molecular cutters which is used to split DNA in the center but…

Q: 3) Analysis of the sequence of a DNA fragment shows the presence of restriction site for the enzyme…

A: The restriction site is the site which is a type of specific genetic sequence present on the DNA…

Q: 3. Why do Class I DNA based transposable elements have terminal inverted repeats?

A: Transposable elements also known as transposons as well as jumping gene. As the name suggests it is…

Q: 6. In 1928, before DNA was recognized as the hereditary material, F Griffith performed a series of…

A: A is Heat killed S-strain which are non virulent as it does not killed the mice and is undetected. B…

Question

5.If the following two primers
3'AAG5'
S'CCG3'
were used to facilitate the polymerase chain reaction with the DNA sequence shown below, no amplification
of the gene would occur. Explain why not. K 5
S'ATTTC-
3'ТАААG
--gene-
-СССТАЗ
GGCATS

Expert Solution

This question has been solved!

Explore an expertly crafted, step-by-step solution for a thorough understanding of key concepts.

SEE SOLUTION Check out a sample Q&A here

Step 1

VIEW

Step 2

VIEW

Step by step

Solved in 2 steps

SEE SOLUTION Check out a sample Q&A here

Knowledge Booster

Learn more about

Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.

Similar questions

Which of the following is/are not required for DNA replication to occur? a. DNA polymerase b. nucleotides c. template DNA d. primers e. helicase f. all are required
The results of a paternity test using short tandem repeats are listed in the table below. Whos the daddy? How sure are you?
After a polymerase chain reaction (PCR), agarose gel electrophoresis is often used to: a. amplify the DNA. b. convert cDNA into genomic DNA. c. convert cDNA into messenger RNA. d. verify that the desired DNA sequence has been amplified. e. synthesize primer DNA molecules.
In the Hershey-Chase experiment with bacteriophages, (a) harmless bacterial cells permanently transformed into virulent cells (b) DNA was shown to be the transforming factor of earlier bacterial transformation experiments (c) the replication of DNA was conclusively shown to be semiconservative (d) viral DNA was shown to enter bacterial cells and cause the production of new viruses within the bacteria (e) viruses injected their proteins, not their DNA, into bacterial cells
Which of the following statements about DNA replication is false? a. Synthesis of the new DNA strand is from 39 to 59. b. Synthesis of the new DNA strand is from 59 to 39. c. DNA unwinds, primase adds RNA primer, and DNApolymerases synthesize the new strand and remove the RNAprimer. d. Many initiation points exist in each eukaryotic chromosome. e. Okazaki fragments are synthesized in the opposite directionfrom the direction in which the replication fork moves.
A binding .site for RNA polymerase is called a ___ . a. gene b. promoter c. codon d. protein
The statement DNA replicates by a semiconservative mechanism means that (a) only one DNA strand is copied (b) first one DNA strand is copied and then the other strand is copied (c) the two strands of a double helix have identical base sequences (d) some portions of a single DNA strand are old and other portions are newly synthesized (e) each double helix consists of one old and one newly synthesized strand
What information and materials are needed to amplify region of DNA using PCR?
1. Why is that DNA polymerase and RNA polymerase can synthesize polynucleotides only from 5' to 3' to direction?
2. You are cloning the genome of a new DNA virus into pUC18. You plate out your transformants on ampicillin plates con-taining X-gal and pick one blue colony and one white colony. When you check the size of the inserts in each plasmid (blueand white), you are surprised to fi nd that the plasmid fromthe blue colony contains a very small insert of approximately60 bp, while the plasmid from the white colony does notappear to contain any insert at all. Explain these results.
2. Give two different reasons for the much higher ratioof total DNA to protein-encoding DNA in the humangenome as compared to bacterial genomes.
2. List the DNA strand sequence complementary to the template strand. CCUGCAGUAUGAAACGCCUGGUAGAAGGUGGGAAGUGGUGCGCCC . . .